EMAIL THIS PAGE TO A FRIEND

EPS8L2

EPS8-like 2

48 Gene Product Result for
Synonyms: EPS8R2
UniProtKB ID: Q9H6S3, B3KSX1, Q53GM8, Q8WYW7, Q96K06, Q9H6K9
Gene ID:
Human(64787) Summary: This gene encodes a member of the EPS8 gene family. The encoded protein, like other members of the family, is thought to link growth factor stimulation to actin organization, generating functional redundancy in the pathways that regulate actin cytoskeletal remodeling. [provided by RefSeq, Dec 2008]
Mouse(98845) EPS8-like 2
Rat(361674) EPS8-like 2
chicken(770081) EPS8-like 2
cow(614857) EPS8-like 2
sheep(101102603) EPS8-like 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022772 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022772 Rosetta Predictions human pricing
NM_001108508 Rosetta Predictions rat pricing
NM_133191 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067714 predicted 2609
2 SASI_Hs01_00067715 predicted 1205
3 SASI_Hs01_00067716 predicted 1241
4 SASI_Hs01_00067717 predicted 2565
5 SASI_Hs01_00067718 predicted 1887
6 SASI_Hs01_00067719 predicted 1765
7 SASI_Hs01_00067720 predicted 1760
8 SASI_Hs01_00067721 predicted 1107
9 SASI_Hs01_00067722 predicted 667
10 SASI_Hs02_00356064 predicted 726
11 SASI_Hs01_00067723 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239339 predicted 1675
2 SASI_Rn02_00239340 predicted 2372
3 SASI_Rn02_00239341 predicted 1943
4 SASI_Rn02_00239342 predicted 1668
5 SASI_Rn02_00239343 predicted 1114
6 SASI_Rn02_00239344 predicted 2424
7 SASI_Rn02_00239345 predicted 1153
8 SASI_Rn02_00239346 predicted 1020
9 SASI_Rn02_00239347 predicted 1490
10 SASI_Rn02_00239348 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078811 predicted 2293
2 SASI_Mm01_00078812 predicted 1074
3 SASI_Mm01_00078813 predicted 220
4 SASI_Mm01_00078814 predicted 640
5 SASI_Mm01_00078815 predicted 1335
6 SASI_Mm01_00078816 predicted 939
7 SASI_Mm01_00078817 predicted 2343
8 SASI_Mm01_00078818 predicted 584
9 SASI_Mm01_00078819 predicted 2281
10 SASI_Mm01_00078820 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133191
VALIDATED
EPS8L2 MISSION shRNA Bacterial Glycerol Stock
EPS8-like 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133191.2-2281s21c1
Sequence:CCGGTGTAATGGGCCCAACCCAAATCTCGAGATTTGGGTTGGGCCCATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133191.2-858s21c1
Sequence:CCGGATAGAGAAGGAGACGCAAATCCTCGAGGATTTGCGTCTCCTTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133191.2-2868s21c1
Sequence:CCGGCCTAAGAATGAACCAGACATACTCGAGTATGTCTGGTTCATTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133191.2-1843s21c1
Sequence:CCGGCAGGGAACAAAGAAGAGCTAACTCGAGTTAGCTCTTCTTTGTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133191.2-1452s21c1
Sequence:CCGGCCCAAGAATCGACTATCTGTACTCGAGTACAGATAGTCGATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133191.2-2868s1c1
Sequence:CCGGCCTAAGAATGAACCAGACATACTCGAGTATGTCTGGTTCATTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133191.2-786s1c1
Sequence:CCGGCCATTCAGTGAACCAGGCTATCTCGAGATAGCCTGGTTCACTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133191.2-1452s1c1
Sequence:CCGGCCCAAGAATCGACTATCTGTACTCGAGTACAGATAGTCGATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133191.2-1843s1c1
Sequence:CCGGCAGGGAACAAAGAAGAGCTAACTCGAGTTAGCTCTTCTTTGTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133191.2-890s1c1
Sequence:CCGGCCTGGATGATATTGAATGGTTCTCGAGAACCATTCAATATCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133191
VALIDATED
EPS8L2 MISSION shRNA shRNA Plasmid DNA
EPS8-like 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133191.2-2281s21c1
Sequence:CCGGTGTAATGGGCCCAACCCAAATCTCGAGATTTGGGTTGGGCCCATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133191.2-858s21c1
Sequence:CCGGATAGAGAAGGAGACGCAAATCCTCGAGGATTTGCGTCTCCTTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133191.2-2868s21c1
Sequence:CCGGCCTAAGAATGAACCAGACATACTCGAGTATGTCTGGTTCATTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133191.2-1843s21c1
Sequence:CCGGCAGGGAACAAAGAAGAGCTAACTCGAGTTAGCTCTTCTTTGTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133191.2-1452s21c1
Sequence:CCGGCCCAAGAATCGACTATCTGTACTCGAGTACAGATAGTCGATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133191.2-2868s1c1
Sequence:CCGGCCTAAGAATGAACCAGACATACTCGAGTATGTCTGGTTCATTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133191.2-786s1c1
Sequence:CCGGCCATTCAGTGAACCAGGCTATCTCGAGATAGCCTGGTTCACTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133191.2-1452s1c1
Sequence:CCGGCCCAAGAATCGACTATCTGTACTCGAGTACAGATAGTCGATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133191.2-1843s1c1
Sequence:CCGGCAGGGAACAAAGAAGAGCTAACTCGAGTTAGCTCTTCTTTGTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133191.2-890s1c1
Sequence:CCGGCCTGGATGATATTGAATGGTTCTCGAGAACCATTCAATATCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133191
VALIDATED
EPS8L2 MISSION shRNA Lentiviral Transduction Particles
EPS8-like 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133191.2-2281s21c1
Sequence:CCGGTGTAATGGGCCCAACCCAAATCTCGAGATTTGGGTTGGGCCCATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133191.2-858s21c1
Sequence:CCGGATAGAGAAGGAGACGCAAATCCTCGAGGATTTGCGTCTCCTTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133191.2-2868s21c1
Sequence:CCGGCCTAAGAATGAACCAGACATACTCGAGTATGTCTGGTTCATTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133191.2-1843s21c1
Sequence:CCGGCAGGGAACAAAGAAGAGCTAACTCGAGTTAGCTCTTCTTTGTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133191.2-1452s21c1
Sequence:CCGGCCCAAGAATCGACTATCTGTACTCGAGTACAGATAGTCGATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133191.2-2868s1c1
Sequence:CCGGCCTAAGAATGAACCAGACATACTCGAGTATGTCTGGTTCATTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133191.2-786s1c1
Sequence:CCGGCCATTCAGTGAACCAGGCTATCTCGAGATAGCCTGGTTCACTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133191.2-1452s1c1
Sequence:CCGGCCCAAGAATCGACTATCTGTACTCGAGTACAGATAGTCGATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133191.2-1843s1c1
Sequence:CCGGCAGGGAACAAAGAAGAGCTAACTCGAGTTAGCTCTTCTTTGTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133191.2-890s1c1
Sequence:CCGGCCTGGATGATATTGAATGGTTCTCGAGAACCATTCAATATCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022772
VALIDATED
EPS8L2 MISSION shRNA Bacterial Glycerol Stock
EPS8-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022772.3-1609s21c1
Sequence:CCGGGTCCATAAGAAACTCCCAGAACTCGAGTTCTGGGAGTTTCTTATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022772.3-1729s21c1
Sequence:CCGGCAAGTACGTCAAGATCCTGTACTCGAGTACAGGATCTTGACGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022772.3-2350s21c1
Sequence:CCGGGAACAAGTTTCATTCCATGAACTCGAGTTCATGGAATGAAACTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022772.3-355s21c1
Sequence:CCGGGAAGAAGTATTCCAACTCCAACTCGAGTTGGAGTTGGAATACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022772.2-380s1c1
Sequence:CCGGGAAGAAGTATTCCAACTCCAACTCGAGTTGGAGTTGGAATACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022772.2-2463s1c1
Sequence:CCGGCCACAATGCATGGAGTATTATCTCGAGATAATACTCCATGCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022772.2-2375s1c1
Sequence:CCGGGAACAAGTTTCATTCCATGAACTCGAGTTCATGGAATGAAACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022772.2-1754s1c1
Sequence:CCGGCAAGTACGTCAAGATCCTGTACTCGAGTACAGGATCTTGACGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022772.2-1634s1c1
Sequence:CCGGGTCCATAAGAAACTCCCAGAACTCGAGTTCTGGGAGTTTCTTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022772
VALIDATED
EPS8L2 MISSION shRNA shRNA Plasmid DNA
EPS8-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022772.3-1609s21c1
Sequence:CCGGGTCCATAAGAAACTCCCAGAACTCGAGTTCTGGGAGTTTCTTATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022772.3-1729s21c1
Sequence:CCGGCAAGTACGTCAAGATCCTGTACTCGAGTACAGGATCTTGACGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022772.3-2350s21c1
Sequence:CCGGGAACAAGTTTCATTCCATGAACTCGAGTTCATGGAATGAAACTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022772.3-355s21c1
Sequence:CCGGGAAGAAGTATTCCAACTCCAACTCGAGTTGGAGTTGGAATACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022772.2-380s1c1
Sequence:CCGGGAAGAAGTATTCCAACTCCAACTCGAGTTGGAGTTGGAATACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022772.2-2463s1c1
Sequence:CCGGCCACAATGCATGGAGTATTATCTCGAGATAATACTCCATGCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022772.2-2375s1c1
Sequence:CCGGGAACAAGTTTCATTCCATGAACTCGAGTTCATGGAATGAAACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022772.2-1754s1c1
Sequence:CCGGCAAGTACGTCAAGATCCTGTACTCGAGTACAGGATCTTGACGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022772.2-1634s1c1
Sequence:CCGGGTCCATAAGAAACTCCCAGAACTCGAGTTCTGGGAGTTTCTTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022772
VALIDATED
EPS8L2 MISSION shRNA Lentiviral Transduction Particles
EPS8-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022772.3-1609s21c1
Sequence:CCGGGTCCATAAGAAACTCCCAGAACTCGAGTTCTGGGAGTTTCTTATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022772.3-1729s21c1
Sequence:CCGGCAAGTACGTCAAGATCCTGTACTCGAGTACAGGATCTTGACGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022772.3-2350s21c1
Sequence:CCGGGAACAAGTTTCATTCCATGAACTCGAGTTCATGGAATGAAACTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022772.3-355s21c1
Sequence:CCGGGAAGAAGTATTCCAACTCCAACTCGAGTTGGAGTTGGAATACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022772.2-380s1c1
Sequence:CCGGGAAGAAGTATTCCAACTCCAACTCGAGTTGGAGTTGGAATACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022772.2-2463s1c1
Sequence:CCGGCCACAATGCATGGAGTATTATCTCGAGATAATACTCCATGCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022772.2-2375s1c1
Sequence:CCGGGAACAAGTTTCATTCCATGAACTCGAGTTCATGGAATGAAACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022772.2-1754s1c1
Sequence:CCGGCAAGTACGTCAAGATCCTGTACTCGAGTACAGGATCTTGACGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022772.2-1634s1c1
Sequence:CCGGGTCCATAAGAAACTCCCAGAACTCGAGTTCTGGGAGTTTCTTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks