EMAIL THIS PAGE TO A FRIEND

EPS8L3

EPS8-like 3

104 Gene Product Result for
Synonyms: EPS8R3
Gene ID:
Human(79574) Summary: This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. Alternatively spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Jul 2008]
Mouse(99662) EPS8-like 3
Rat(295361) EPS8-like 3
sheep(101109134) EPS8-like 3
Zebrafish(393332) EPS8-like 3
cow(504611) EPS8-like 3
Horse(100061856) EPS8-like 3
dog(490118) EPS8-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024526 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102291 MISSION® esiRNA esiRNA human EPS8L3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024526 Rosetta Predictions human pricing
NM_133181 Rosetta Predictions human pricing
NM_139053 Rosetta Predictions human pricing
NM_001106463 Rosetta Predictions rat pricing
NM_133867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030999 predicted 1909
2 SASI_Hs01_00031000 predicted 325
3 SASI_Hs01_00031001 predicted 1597
4 SASI_Hs01_00031002 predicted 1617
5 SASI_Hs01_00031003 predicted 1820
6 SASI_Hs01_00031004 predicted 1640
7 SASI_Hs01_00031005 predicted 1744
8 SASI_Hs01_00031006 predicted 1823
9 SASI_Hs01_00031008 predicted 1880
10 SASI_Hs02_00356818 predicted 1872
11 SASI_Hs01_00031007 predicted 1845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199614 predicted 1992
2 SASI_Hs01_00199615 predicted 328
3 SASI_Hs01_00199616 predicted 1687
4 SASI_Hs01_00199617 predicted 1701
5 SASI_Hs01_00199618 predicted 1913
6 SASI_Hs01_00199619 predicted 1729
7 SASI_Hs01_00199620 predicted 1836
8 SASI_Hs01_00199621 predicted 1918
9 SASI_Hs01_00199623 predicted 1974
10 SASI_Hs02_00362961 predicted 1959
11 SASI_Hs01_00199622 predicted 1930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196651 predicted 2001
2 SASI_Hs01_00196652 predicted 322
3 SASI_Hs01_00196653 predicted 1689
4 SASI_Hs01_00196654 predicted 1709
5 SASI_Hs01_00196655 predicted 1920
6 SASI_Hs01_00196656 predicted 1735
7 SASI_Hs01_00196657 predicted 1838
8 SASI_Hs01_00196658 predicted 1918
9 SASI_Hs01_00196660 predicted 1974
10 SASI_Hs02_00364106 predicted 1960
11 SASI_Hs01_00196659 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219208 predicted 293
2 SASI_Rn02_00219209 predicted 458
3 SASI_Rn02_00219210 predicted 1481
4 SASI_Rn02_00219211 predicted 1468
5 SASI_Rn02_00219212 predicted 451
6 SASI_Rn02_00219213 predicted 1664
7 SASI_Rn02_00219214 predicted 1482
8 SASI_Rn02_00219215 predicted 402
9 SASI_Rn02_00219216 predicted 281
10 SASI_Rn02_00219217 predicted 1737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120151 predicted 1395
2 SASI_Mm02_00338922 predicted 311
3 SASI_Mm01_00120153 predicted 474
4 SASI_Mm01_00120154 predicted 682
5 SASI_Mm02_00338923 predicted 196
6 SASI_Mm02_00338924 predicted 440
7 SASI_Mm02_00338925 predicted 1818
8 SASI_Mm01_00120156 predicted 1615
9 SASI_Mm01_00120157 predicted 763
10 SASI_Mm02_00338926 predicted 481
11 SASI_Mm01_00120150 predicted 1459
12 SASI_Mm01_00120152 predicted 374
13 SASI_Mm01_00120155 predicted 1483
14 SASI_Mm01_00120158 predicted 245
15 SASI_Mm01_00120159 predicted 1507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024526
EPS8L3 MISSION shRNA Bacterial Glycerol Stock
EPS8-like 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-1543s1c1
Sequence:CCGGCGGCTACATTCCAAGCAACATCTCGAGATGTTGCTTGGAATGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-1081s1c1
Sequence:CCGGGCTCGTACACATCCTCTTCAACTCGAGTTGAAGAGGATGTGTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-451s1c1
Sequence:CCGGGCTCAACACATGTTCCTACAACTCGAGTTGTAGGAACATGTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-1175s1c1
Sequence:CCGGCCTAAAGCTATCAACCTGCTACTCGAGTAGCAGGTTGATAGCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-1009s1c1
Sequence:CCGGCCAGAAGATCAAGCACAGCTTCTCGAGAAGCTGTGCTTGATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024526.2-1430s21c1
Sequence:CCGGTACGAGTTTGAAGCTAGGAACCTCGAGGTTCCTAGCTTCAAACTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024526.2-1884s21c1
Sequence:CCGGTGGCAGATCTGATACCCATTACTCGAGTAATGGGTATCAGATCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024526.2-426s21c1
Sequence:CCGGACAGCATCCAGGCCATGAATGCTCGAGCATTCATGGCCTGGATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024526.2-1722s21c1
Sequence:CCGGGGAGCCAGCTACTTCGCATAACTCGAGTTATGCGAAGTAGCTGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024526
EPS8L3 MISSION shRNA shRNA Plasmid DNA
EPS8-like 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-1543s1c1
Sequence:CCGGCGGCTACATTCCAAGCAACATCTCGAGATGTTGCTTGGAATGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-1081s1c1
Sequence:CCGGGCTCGTACACATCCTCTTCAACTCGAGTTGAAGAGGATGTGTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-451s1c1
Sequence:CCGGGCTCAACACATGTTCCTACAACTCGAGTTGTAGGAACATGTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-1175s1c1
Sequence:CCGGCCTAAAGCTATCAACCTGCTACTCGAGTAGCAGGTTGATAGCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-1009s1c1
Sequence:CCGGCCAGAAGATCAAGCACAGCTTCTCGAGAAGCTGTGCTTGATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024526.2-1430s21c1
Sequence:CCGGTACGAGTTTGAAGCTAGGAACCTCGAGGTTCCTAGCTTCAAACTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024526.2-1884s21c1
Sequence:CCGGTGGCAGATCTGATACCCATTACTCGAGTAATGGGTATCAGATCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024526.2-426s21c1
Sequence:CCGGACAGCATCCAGGCCATGAATGCTCGAGCATTCATGGCCTGGATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024526.2-1722s21c1
Sequence:CCGGGGAGCCAGCTACTTCGCATAACTCGAGTTATGCGAAGTAGCTGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024526
EPS8L3 MISSION shRNA Lentiviral Transduction Particles
EPS8-like 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-1543s1c1
Sequence:CCGGCGGCTACATTCCAAGCAACATCTCGAGATGTTGCTTGGAATGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-1081s1c1
Sequence:CCGGGCTCGTACACATCCTCTTCAACTCGAGTTGAAGAGGATGTGTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-451s1c1
Sequence:CCGGGCTCAACACATGTTCCTACAACTCGAGTTGTAGGAACATGTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-1175s1c1
Sequence:CCGGCCTAAAGCTATCAACCTGCTACTCGAGTAGCAGGTTGATAGCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024526.2-1009s1c1
Sequence:CCGGCCAGAAGATCAAGCACAGCTTCTCGAGAAGCTGTGCTTGATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024526.2-1430s21c1
Sequence:CCGGTACGAGTTTGAAGCTAGGAACCTCGAGGTTCCTAGCTTCAAACTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024526.2-1884s21c1
Sequence:CCGGTGGCAGATCTGATACCCATTACTCGAGTAATGGGTATCAGATCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024526.2-426s21c1
Sequence:CCGGACAGCATCCAGGCCATGAATGCTCGAGCATTCATGGCCTGGATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024526.2-1722s21c1
Sequence:CCGGGGAGCCAGCTACTTCGCATAACTCGAGTTATGCGAAGTAGCTGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133867
EPS8L3 MISSION shRNA Bacterial Glycerol Stock
EPS8-like 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133867.1-627s1c1
Sequence:CCGGGCTAGAAGAAAGACCTCGATTCTCGAGAATCGAGGTCTTTCTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133867.1-772s1c1
Sequence:CCGGCCACATAACATGACCTCAGAACTCGAGTTCTGAGGTCATGTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133867.1-933s1c1
Sequence:CCGGCCTAAGAGACATTGAGCTGTTCTCGAGAACAGCTCAATGTCTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133867.1-2085s1c1
Sequence:CCGGCCACATATCCTGGATCACAAACTCGAGTTTGTGATCCAGGATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133867.1-1071s1c1
Sequence:CCGGGAAGATCAAGTTGAGCTTCAACTCGAGTTGAAGCTCAACTTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133867.2-1959s21c1
Sequence:CCGGCATTAGAGACCAGCTCGAATACTCGAGTATTCGAGCTGGTCTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133867
EPS8L3 MISSION shRNA shRNA Plasmid DNA
EPS8-like 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133867.1-627s1c1
Sequence:CCGGGCTAGAAGAAAGACCTCGATTCTCGAGAATCGAGGTCTTTCTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133867.1-772s1c1
Sequence:CCGGCCACATAACATGACCTCAGAACTCGAGTTCTGAGGTCATGTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133867.1-933s1c1
Sequence:CCGGCCTAAGAGACATTGAGCTGTTCTCGAGAACAGCTCAATGTCTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133867.1-2085s1c1
Sequence:CCGGCCACATATCCTGGATCACAAACTCGAGTTTGTGATCCAGGATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133867.1-1071s1c1
Sequence:CCGGGAAGATCAAGTTGAGCTTCAACTCGAGTTGAAGCTCAACTTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133867.2-1959s21c1
Sequence:CCGGCATTAGAGACCAGCTCGAATACTCGAGTATTCGAGCTGGTCTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133867
EPS8L3 MISSION shRNA Lentiviral Transduction Particles
EPS8-like 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133867.1-627s1c1
Sequence:CCGGGCTAGAAGAAAGACCTCGATTCTCGAGAATCGAGGTCTTTCTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133867.1-772s1c1
Sequence:CCGGCCACATAACATGACCTCAGAACTCGAGTTCTGAGGTCATGTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133867.1-933s1c1
Sequence:CCGGCCTAAGAGACATTGAGCTGTTCTCGAGAACAGCTCAATGTCTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133867.1-2085s1c1
Sequence:CCGGCCACATATCCTGGATCACAAACTCGAGTTTGTGATCCAGGATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133867.1-1071s1c1
Sequence:CCGGGAAGATCAAGTTGAGCTTCAACTCGAGTTGAAGCTCAACTTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133867.2-1959s21c1
Sequence:CCGGCATTAGAGACCAGCTCGAATACTCGAGTATTCGAGCTGGTCTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks