EMAIL THIS PAGE TO A FRIEND

EPSTI1

epithelial stromal interaction 1 (breast)

99 Gene Product Result for
Synonyms: BRESI1
UniProtKB ID: Q96J88, Q8IVC7, Q8NDQ7
Gene ID:
Mouse(108670) epithelial stromal interaction 1 (breast)
Rat(498547) epithelial stromal interaction 1 (breast)
Zebrafish(101884931) epithelial stromal interaction 1
cow(614555) epithelial stromal interaction 1 (breast)
domestic cat(101089570) epithelial stromal interaction 1 (breast)
dog(476931) epithelial stromal interaction 1 (breast)
chicken(418837) epithelial stromal interaction 1 (breast)
sheep(101123642) epithelial stromal interaction 1 (breast)
naked mole-rat(101724990) epithelial stromal interaction 1 (breast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033255 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002264 Rosetta Predictions human pricing
NM_033255 Rosetta Predictions human pricing
NM_001044257 Rosetta Predictions rat pricing
NM_029495 Rosetta Predictions mouse pricing
NM_178825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116202 predicted 278
2 SASI_Hs01_00116203 predicted 1324
3 SASI_Hs01_00116204 predicted 442
4 SASI_Hs02_00304154 predicted 1322
5 SASI_Hs01_00116205 predicted 420
6 SASI_Hs02_00304155 predicted 274
7 SASI_Hs01_00116206 predicted 408
8 SASI_Hs01_00116207 predicted 1278
9 SASI_Hs01_00116208 predicted 1308
10 SASI_Hs02_00304156 predicted 445
11 SASI_Hs01_00116200 predicted 458
12 SASI_Hs01_00116201 predicted 1332
13 SASI_Hs01_00116209 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107492 predicted 278
2 SASI_Hs01_00107493 predicted 1258
3 SASI_Hs01_00107494 predicted 443
4 SASI_Hs02_00361052 predicted 1257
5 SASI_Hs01_00107495 predicted 417
6 SASI_Hs02_00361053 predicted 274
7 SASI_Hs01_00107496 predicted 416
8 SASI_Hs01_00107497 predicted 1211
9 SASI_Hs01_00107498 predicted 1242
10 SASI_Hs02_00361054 predicted 438
11 SASI_Hs01_00107490 predicted 456
12 SASI_Hs01_00107491 predicted 1266
13 SASI_Hs01_00107499 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044257 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205277 predicted 687
2 SASI_Rn02_00205278 predicted 493
3 SASI_Rn02_00205279 predicted 467
4 SASI_Rn02_00205280 predicted 618
5 SASI_Rn02_00205281 predicted 1117
6 SASI_Rn02_00205282 predicted 1079
7 SASI_Rn02_00205283 predicted 1085
8 SASI_Rn02_00205284 predicted 777
9 SASI_Rn02_00205285 predicted 449
10 SASI_Rn02_00205286 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196007 predicted 275
2 SASI_Mm02_00335431 predicted 444
3 SASI_Mm02_00335432 predicted 500
4 SASI_Mm01_00196009 predicted 320
5 SASI_Mm01_00196011 predicted 291
6 SASI_Mm01_00196012 predicted 300
7 SASI_Mm02_00335433 predicted 506
8 SASI_Mm02_00335434 predicted 468
9 SASI_Mm02_00335435 predicted 467
10 SASI_Mm01_00196013 predicted 284
11 SASI_Mm01_00196008 predicted 341
12 SASI_Mm01_00196010 predicted 317
13 SASI_Mm01_00196014 predicted 317
14 SASI_Mm01_00196015 predicted 346
15 SASI_Mm01_00196016 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097762 predicted 244
2 SASI_Mm02_00349411 predicted 413
3 SASI_Mm02_00349412 predicted 467
4 SASI_Mm01_00097764 predicted 287
5 SASI_Mm01_00097766 predicted 265
6 SASI_Mm01_00097767 predicted 265
7 SASI_Mm02_00349413 predicted 480
8 SASI_Mm02_00349414 predicted 440
9 SASI_Mm02_00349415 predicted 436
10 SASI_Mm01_00097768 predicted 263
11 SASI_Mm01_00097763 predicted 308
12 SASI_Mm01_00097765 predicted 297
13 SASI_Mm01_00097769 predicted 282
14 SASI_Mm01_00097770 predicted 312
15 SASI_Mm01_00097771 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033255
VALIDATED
EPSTI1 MISSION shRNA Bacterial Glycerol Stock
epithelial stromal interaction 1 (breast)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033255.2-449s21c1
Sequence:CCGGCTCCAGCTGATGCAATCTAAACTCGAGTTTAGATTGCATCAGCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033255.2-878s21c1
Sequence:CCGGACTGAACACAGGAGGGTAAATCTCGAGATTTACCCTCCTGTGTTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033255.2-277s21c1
Sequence:CCGGCACCTTGATAGCACCAAATATCTCGAGATATTTGGTGCTATCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033255.1-347s1c1
Sequence:CCGGGAAGGAGCAGAACAGAGCTAACTCGAGTTAGCTCTGTTCTGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033255.1-508s1c1
Sequence:CCGGCTGAAGAAGCTGAACTCCAAACTCGAGTTTGGAGTTCAGCTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033255.1-291s1c1
Sequence:CCGGCGGAGAAATGAGATACAAAGACTCGAGTCTTTGTATCTCATTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033255.1-806s1c1
Sequence:CCGGGAGTGAATTACTGGAACTGAACTCGAGTTCAGTTCCAGTAATTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033255.1-952s1c1
Sequence:CCGGGTTGGAATATGAATAGCGGTACTCGAGTACCGCTATTCATATTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033255.1-411s1c1
Sequence:CCGGGAAACTGAAGTCAGACAGAAACTCGAGTTTCTGTCTGACTTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033255
VALIDATED
EPSTI1 MISSION shRNA shRNA Plasmid DNA
epithelial stromal interaction 1 (breast)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033255.2-449s21c1
Sequence:CCGGCTCCAGCTGATGCAATCTAAACTCGAGTTTAGATTGCATCAGCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033255.2-878s21c1
Sequence:CCGGACTGAACACAGGAGGGTAAATCTCGAGATTTACCCTCCTGTGTTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033255.2-277s21c1
Sequence:CCGGCACCTTGATAGCACCAAATATCTCGAGATATTTGGTGCTATCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033255.1-347s1c1
Sequence:CCGGGAAGGAGCAGAACAGAGCTAACTCGAGTTAGCTCTGTTCTGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033255.1-508s1c1
Sequence:CCGGCTGAAGAAGCTGAACTCCAAACTCGAGTTTGGAGTTCAGCTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033255.1-291s1c1
Sequence:CCGGCGGAGAAATGAGATACAAAGACTCGAGTCTTTGTATCTCATTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033255.1-806s1c1
Sequence:CCGGGAGTGAATTACTGGAACTGAACTCGAGTTCAGTTCCAGTAATTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033255.1-952s1c1
Sequence:CCGGGTTGGAATATGAATAGCGGTACTCGAGTACCGCTATTCATATTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033255.1-411s1c1
Sequence:CCGGGAAACTGAAGTCAGACAGAAACTCGAGTTTCTGTCTGACTTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033255
VALIDATED
EPSTI1 MISSION shRNA Lentiviral Transduction Particles
epithelial stromal interaction 1 (breast)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033255.2-449s21c1
Sequence:CCGGCTCCAGCTGATGCAATCTAAACTCGAGTTTAGATTGCATCAGCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033255.2-878s21c1
Sequence:CCGGACTGAACACAGGAGGGTAAATCTCGAGATTTACCCTCCTGTGTTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033255.2-277s21c1
Sequence:CCGGCACCTTGATAGCACCAAATATCTCGAGATATTTGGTGCTATCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033255.1-347s1c1
Sequence:CCGGGAAGGAGCAGAACAGAGCTAACTCGAGTTAGCTCTGTTCTGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033255.1-508s1c1
Sequence:CCGGCTGAAGAAGCTGAACTCCAAACTCGAGTTTGGAGTTCAGCTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033255.1-291s1c1
Sequence:CCGGCGGAGAAATGAGATACAAAGACTCGAGTCTTTGTATCTCATTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033255.1-806s1c1
Sequence:CCGGGAGTGAATTACTGGAACTGAACTCGAGTTCAGTTCCAGTAATTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033255.1-952s1c1
Sequence:CCGGGTTGGAATATGAATAGCGGTACTCGAGTACCGCTATTCATATTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033255.1-411s1c1
Sequence:CCGGGAAACTGAAGTCAGACAGAAACTCGAGTTTCTGTCTGACTTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178825
EPSTI1 MISSION shRNA Bacterial Glycerol Stock
epithelial stromal interaction 1 (breast)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178825.1-417s1c1
Sequence:CCGGGAGGCTGAAGTCAGACAGAAACTCGAGTTTCTGTCTGACTTCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178825.1-312s1c1
Sequence:CCGGCAGAGAATTGCTGAGCAAGAACTCGAGTTCTTGCTCAGCAATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178825.1-446s1c1
Sequence:CCGGGCAACAGATGCGTTCTAAATACTCGAGTATTTAGAACGCATCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178825.1-880s1c1
Sequence:CCGGGCTTGTGTTTGTTCCCAACATCTCGAGATGTTGGGAACAAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178825
EPSTI1 MISSION shRNA shRNA Plasmid DNA
epithelial stromal interaction 1 (breast)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178825.1-417s1c1
Sequence:CCGGGAGGCTGAAGTCAGACAGAAACTCGAGTTTCTGTCTGACTTCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178825.1-312s1c1
Sequence:CCGGCAGAGAATTGCTGAGCAAGAACTCGAGTTCTTGCTCAGCAATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178825.1-446s1c1
Sequence:CCGGGCAACAGATGCGTTCTAAATACTCGAGTATTTAGAACGCATCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178825.1-880s1c1
Sequence:CCGGGCTTGTGTTTGTTCCCAACATCTCGAGATGTTGGGAACAAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178825
EPSTI1 MISSION shRNA Lentiviral Transduction Particles
epithelial stromal interaction 1 (breast)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178825.1-417s1c1
Sequence:CCGGGAGGCTGAAGTCAGACAGAAACTCGAGTTTCTGTCTGACTTCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178825.1-312s1c1
Sequence:CCGGCAGAGAATTGCTGAGCAAGAACTCGAGTTCTTGCTCAGCAATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178825.1-446s1c1
Sequence:CCGGGCAACAGATGCGTTCTAAATACTCGAGTATTTAGAACGCATCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178825.1-880s1c1
Sequence:CCGGGCTTGTGTTTGTTCCCAACATCTCGAGATGTTGGGAACAAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks