EMAIL THIS PAGE TO A FRIEND

EPT1

ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)

287 Gene Product Result for
Synonyms: SELI SEPI
UniProtKB ID: Q9C0D9, Q63ZE3
Gene ID:
Human(85465) Summary: This gene encodes a selenoprotein, which contains a selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3' UTR of selenoprotein genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, Jul 2008]
Mouse(28042) ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
Rat(554290) Estrogen-induced pituitary tumorigenesis QTL 1
naked mole-rat(101696807) ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
domestic guinea pig(100724114) ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
sheep(101110487) ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
chicken(428661) ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
dog(100302747) ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
cow(506381) ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
domestic cat(101083765) ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302271 ANTI-SELI (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033505 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027652 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027652 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027652 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033505 Rosetta Predictions human pricing
NM_027652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170095 predicted 800
2 SASI_Hs01_00170096 predicted 896
3 SASI_Hs01_00170097 predicted 274
4 SASI_Hs01_00170098 predicted 1354
5 SASI_Hs01_00170099 predicted 1215
6 SASI_Hs01_00170100 predicted 703
7 SASI_Hs01_00170101 predicted 753
8 SASI_Hs01_00170102 predicted 1051
9 SASI_Hs01_00170104 predicted 999
10 SASI_Hs02_00361377 predicted 910
11 SASI_Hs01_00170103 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020446 predicted 1217
2 SASI_Mm01_00020447 predicted 375
3 SASI_Mm01_00020449 predicted 1052
4 SASI_Mm01_00020450 predicted 989
5 SASI_Mm01_00020451 predicted 806
6 SASI_Mm01_00020452 predicted 691
7 SASI_Mm01_00020453 predicted 428
8 SASI_Mm02_00332529 predicted 989
9 SASI_Mm01_00020454 predicted 1281
10 SASI_Mm02_00332530 predicted 227
11 SASI_Mm01_00020448 predicted 225
12 SASI_Mm01_00020455 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033505
VALIDATED
EPT1 MISSION shRNA Bacterial Glycerol Stock
ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_033505.1-2839s1c1
Sequence:CCGGCGGCACTAACTCATGGTTCTACTCGAGTAGAACCATGAGTTAGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_033505.1-4404s1c1
Sequence:CCGGGCCTGAGCTTTGGGAGAATATCTCGAGATATTCTCCCAAAGCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033505.1-453s1c1
Sequence:CCGGCGCAGAACCAATTCTAGCACTCTCGAGAGTGCTAGAATTGGTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_033505.1-977s1c1
Sequence:CCGGGCTACATCCTAGAGTATTCTACTCGAGTAGAATACTCTAGGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033505.1-4437s1c1
Sequence:CCGGGCAGGCATAGTTTCCACTTTACTCGAGTAAAGTGGAAACTATGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033505.1-4087s1c1
Sequence:CCGGGCCACAGTTTACAGTGTCATTCTCGAGAATGACACTGTAAACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033505
VALIDATED
EPT1 MISSION shRNA shRNA Plasmid DNA
ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_033505.1-2839s1c1
Sequence:CCGGCGGCACTAACTCATGGTTCTACTCGAGTAGAACCATGAGTTAGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_033505.1-4404s1c1
Sequence:CCGGGCCTGAGCTTTGGGAGAATATCTCGAGATATTCTCCCAAAGCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033505.1-453s1c1
Sequence:CCGGCGCAGAACCAATTCTAGCACTCTCGAGAGTGCTAGAATTGGTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_033505.1-977s1c1
Sequence:CCGGGCTACATCCTAGAGTATTCTACTCGAGTAGAATACTCTAGGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033505.1-4437s1c1
Sequence:CCGGGCAGGCATAGTTTCCACTTTACTCGAGTAAAGTGGAAACTATGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033505.1-4087s1c1
Sequence:CCGGGCCACAGTTTACAGTGTCATTCTCGAGAATGACACTGTAAACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033505
VALIDATED
EPT1 MISSION shRNA Lentiviral Transduction Particles
ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_033505.1-2839s1c1
Sequence:CCGGCGGCACTAACTCATGGTTCTACTCGAGTAGAACCATGAGTTAGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_033505.1-4404s1c1
Sequence:CCGGGCCTGAGCTTTGGGAGAATATCTCGAGATATTCTCCCAAAGCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033505.1-453s1c1
Sequence:CCGGCGCAGAACCAATTCTAGCACTCTCGAGAGTGCTAGAATTGGTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_033505.1-977s1c1
Sequence:CCGGGCTACATCCTAGAGTATTCTACTCGAGTAGAATACTCTAGGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033505.1-4437s1c1
Sequence:CCGGGCAGGCATAGTTTCCACTTTACTCGAGTAAAGTGGAAACTATGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033505.1-4087s1c1
Sequence:CCGGGCCACAGTTTACAGTGTCATTCTCGAGAATGACACTGTAAACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027652
VALIDATED
EPT1 MISSION shRNA Bacterial Glycerol Stock
ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027652.1-1844s1c1
Sequence:CCGGCGGCTCTTACTGTATCTGATACTCGAGTATCAGATACAGTAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027652.1-235s1c1
Sequence:CCGGGCTCCCAATCTTATAACCTTTCTCGAGAAAGGTTATAAGATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027652.1-278s1c1
Sequence:CCGGTCAATTTCCTACTCCTGACATCTCGAGATGTCAGGAGTAGGAAATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027652.1-1162s1c1
Sequence:CCGGGCTCACATCCATTATGGCGTACTCGAGTACGCCATAATGGATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027652.1-954s1c1
Sequence:CCGGCCCTAGAATATTCTACTTCATCTCGAGATGAAGTAGAATATTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027652.2-416s21c1
Sequence:CCGGTCGTGGGCATCCTCAACTTTGCTCGAGCAAAGTTGAGGATGCCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027652.2-1046s21c1
Sequence:CCGGATATCACATGTCAGCTAATTGCTCGAGCAATTAGCTGACATGTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027652.2-800s21c1
Sequence:CCGGACCTATTCACTGCAATGATTACTCGAGTAATCATTGCAGTGAATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027652.2-1491s21c1
Sequence:CCGGTAACTCCCAGCTTACTCTATTCTCGAGAATAGAGTAAGCTGGGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027652.2-1712s21c1
Sequence:CCGGATACGTTATGGTCGGTCTTTACTCGAGTAAAGACCGACCATAACGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027652
VALIDATED
EPT1 MISSION shRNA shRNA Plasmid DNA
ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027652.1-1844s1c1
Sequence:CCGGCGGCTCTTACTGTATCTGATACTCGAGTATCAGATACAGTAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027652.1-235s1c1
Sequence:CCGGGCTCCCAATCTTATAACCTTTCTCGAGAAAGGTTATAAGATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027652.1-278s1c1
Sequence:CCGGTCAATTTCCTACTCCTGACATCTCGAGATGTCAGGAGTAGGAAATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027652.1-1162s1c1
Sequence:CCGGGCTCACATCCATTATGGCGTACTCGAGTACGCCATAATGGATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027652.1-954s1c1
Sequence:CCGGCCCTAGAATATTCTACTTCATCTCGAGATGAAGTAGAATATTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027652.2-416s21c1
Sequence:CCGGTCGTGGGCATCCTCAACTTTGCTCGAGCAAAGTTGAGGATGCCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027652.2-1046s21c1
Sequence:CCGGATATCACATGTCAGCTAATTGCTCGAGCAATTAGCTGACATGTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027652.2-800s21c1
Sequence:CCGGACCTATTCACTGCAATGATTACTCGAGTAATCATTGCAGTGAATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027652.2-1491s21c1
Sequence:CCGGTAACTCCCAGCTTACTCTATTCTCGAGAATAGAGTAAGCTGGGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027652.2-1712s21c1
Sequence:CCGGATACGTTATGGTCGGTCTTTACTCGAGTAAAGACCGACCATAACGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027652
VALIDATED
EPT1 MISSION shRNA Lentiviral Transduction Particles
ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027652.1-1844s1c1
Sequence:CCGGCGGCTCTTACTGTATCTGATACTCGAGTATCAGATACAGTAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027652.1-235s1c1
Sequence:CCGGGCTCCCAATCTTATAACCTTTCTCGAGAAAGGTTATAAGATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027652.1-278s1c1
Sequence:CCGGTCAATTTCCTACTCCTGACATCTCGAGATGTCAGGAGTAGGAAATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027652.1-1162s1c1
Sequence:CCGGGCTCACATCCATTATGGCGTACTCGAGTACGCCATAATGGATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027652.1-954s1c1
Sequence:CCGGCCCTAGAATATTCTACTTCATCTCGAGATGAAGTAGAATATTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027652.2-416s21c1
Sequence:CCGGTCGTGGGCATCCTCAACTTTGCTCGAGCAAAGTTGAGGATGCCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027652.2-1046s21c1
Sequence:CCGGATATCACATGTCAGCTAATTGCTCGAGCAATTAGCTGACATGTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027652.2-800s21c1
Sequence:CCGGACCTATTCACTGCAATGATTACTCGAGTAATCATTGCAGTGAATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027652.2-1491s21c1
Sequence:CCGGTAACTCCCAGCTTACTCTATTCTCGAGAATAGAGTAAGCTGGGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027652.2-1712s21c1
Sequence:CCGGATACGTTATGGTCGGTCTTTACTCGAGTAAAGACCGACCATAACGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks