EMAIL THIS PAGE TO A FRIEND

EPX

eosinophil peroxidase

158 Gene Product Result for
Synonyms: EPO EPP EPX-PEN
UniProtKB ID: P11678, Q4TVP3
Gene ID:
Human(8288) Summary: This gene is a member of the peroxidase gene family and is expressed in eosinophils. The encoded precursor protein is processed into covalently attached heavy and light chains to form the mature enzyme, which functions as an oxidant. The enzyme is released at sites of parasitic infection or allergen stimulation to mediate lysis of protozoa or parasitic worms. The gene is found in a cluster of three peroxidase genes at chromosome 17q23. Mutations in this gene result in eosinophil peroxidase deficiency. [provided by RefSeq, Sep 2009]
Mouse(13861) eosinophil peroxidase
Rat(303414) eosinophil peroxidase
sheep(101104328) eosinophil peroxidase
Domestic Rabbit(100356393) eosinophil peroxidase
domestic guinea pig(100720135) eosinophil peroxidase
naked mole-rat(101706026) eosinophil peroxidase
dog(491109) eosinophil peroxidase
cow(788751) eosinophil peroxidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000502 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000502 Rosetta Predictions human pricing
NM_001107037 Rosetta Predictions rat pricing
NM_007946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302677 predicted 2120
2 SASI_Hs02_00302678 predicted 2095
3 SASI_Hs01_00165141 predicted 333
4 SASI_Hs02_00302679 predicted 2087
5 SASI_Hs01_00165142 predicted 1829
6 SASI_Hs01_00165144 predicted 232
7 SASI_Hs01_00165146 predicted 1883
8 SASI_Hs01_00165147 predicted 1892
9 SASI_Hs02_00302680 predicted 2131
10 SASI_Hs02_00302681 predicted 2206
11 SASI_Hs01_00165143 predicted 909
12 SASI_Hs01_00165145 predicted 369
13 SASI_Hs01_00165148 predicted 379
14 SASI_Hs01_00165149 predicted 1121
15 SASI_Hs01_00165150 predicted 1914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224866 predicted 1688
2 SASI_Rn02_00224867 predicted 1277
3 SASI_Rn02_00224868 predicted 552
4 SASI_Rn02_00224869 predicted 2120
5 SASI_Rn02_00224870 predicted 1013
6 SASI_Rn02_00224871 predicted 931
7 SASI_Rn02_00224872 predicted 542
8 SASI_Rn02_00224873 predicted 224
9 SASI_Rn02_00224874 predicted 1911
10 SASI_Rn02_00224875 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312800 predicted 2324
2 SASI_Mm02_00312801 predicted 2244
3 SASI_Mm02_00312802 predicted 1865
4 SASI_Mm02_00312803 predicted 544
5 SASI_Mm02_00312804 predicted 1700
6 SASI_Mm01_00026700 predicted 2117
7 SASI_Mm01_00026701 predicted 563
8 SASI_Mm01_00026706 predicted 456
9 SASI_Mm02_00312805 predicted 1348
10 SASI_Mm02_00312806 predicted 292
11 SASI_Mm01_00026697 predicted 2191
12 SASI_Mm01_00026698 predicted 1926
13 SASI_Mm01_00026699 predicted 1010
14 SASI_Mm01_00026702 predicted 1704
15 SASI_Mm01_00026703 predicted 1915
16 SASI_Mm01_00026704 predicted 1383
17 SASI_Mm01_00026705 predicted 560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000502
EPX MISSION shRNA Bacterial Glycerol Stock
eosinophil peroxidase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000502.4-2122s21c1
Sequence:CCGGGAATTTCCTTGTCTCGAATTACTCGAGTAATTCGAGACAAGGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-1748s1c1
Sequence:CCGGCCCGGAATTTGGCACAGCTTACTCGAGTAAGCTGTGCCAAATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-295s1c1
Sequence:CCGGCTGCTTGAAGAGAAGTTACAACTCGAGTTGTAACTTCTCTTCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-1579s1c1
Sequence:CCGGGCCAAGCTGAACCGTCAGGATCTCGAGATCCTGACGGTTCAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-211s1c1
Sequence:CCGGGACCTCCTGTCCTACTTCAAACTCGAGTTTGAAGTAGGACAGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-831s1c1
Sequence:CCGGCCAGCGTGACTGCATCCCTTTCTCGAGAAAGGGATGCAGTCACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000502
EPX MISSION shRNA shRNA Plasmid DNA
eosinophil peroxidase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000502.4-2122s21c1
Sequence:CCGGGAATTTCCTTGTCTCGAATTACTCGAGTAATTCGAGACAAGGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-1748s1c1
Sequence:CCGGCCCGGAATTTGGCACAGCTTACTCGAGTAAGCTGTGCCAAATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-295s1c1
Sequence:CCGGCTGCTTGAAGAGAAGTTACAACTCGAGTTGTAACTTCTCTTCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-1579s1c1
Sequence:CCGGGCCAAGCTGAACCGTCAGGATCTCGAGATCCTGACGGTTCAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-211s1c1
Sequence:CCGGGACCTCCTGTCCTACTTCAAACTCGAGTTTGAAGTAGGACAGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-831s1c1
Sequence:CCGGCCAGCGTGACTGCATCCCTTTCTCGAGAAAGGGATGCAGTCACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000502
EPX MISSION shRNA Lentiviral Transduction Particles
eosinophil peroxidase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000502.4-2122s21c1
Sequence:CCGGGAATTTCCTTGTCTCGAATTACTCGAGTAATTCGAGACAAGGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-1748s1c1
Sequence:CCGGCCCGGAATTTGGCACAGCTTACTCGAGTAAGCTGTGCCAAATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-295s1c1
Sequence:CCGGCTGCTTGAAGAGAAGTTACAACTCGAGTTGTAACTTCTCTTCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-1579s1c1
Sequence:CCGGGCCAAGCTGAACCGTCAGGATCTCGAGATCCTGACGGTTCAGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-211s1c1
Sequence:CCGGGACCTCCTGTCCTACTTCAAACTCGAGTTTGAAGTAGGACAGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000502.1-831s1c1
Sequence:CCGGCCAGCGTGACTGCATCCCTTTCTCGAGAAAGGGATGCAGTCACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007946
EPX MISSION shRNA Bacterial Glycerol Stock
eosinophil peroxidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007946.1-2308s1c1
Sequence:CCGGCAAGCCTTGAAGATGAGGGTACTCGAGTACCCTCATCTTCAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007946.1-279s1c1
Sequence:CCGGGCCTACAATCACACACAGAAACTCGAGTTTCTGTGTGTGATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007946.1-1103s1c1
Sequence:CCGGGCTCCGTAATAGGACCAACTTCTCGAGAAGTTGGTCCTATTACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007946.1-2146s1c1
Sequence:CCGGCTCGGATTGTATGCGACAATACTCGAGTATTGTCGCATACAATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007946.1-2133s1c1
Sequence:CCGGCGAATCTCTTTATCTCGGATTCTCGAGAATCCGAGATAAAGAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007946
EPX MISSION shRNA shRNA Plasmid DNA
eosinophil peroxidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007946.1-2308s1c1
Sequence:CCGGCAAGCCTTGAAGATGAGGGTACTCGAGTACCCTCATCTTCAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007946.1-279s1c1
Sequence:CCGGGCCTACAATCACACACAGAAACTCGAGTTTCTGTGTGTGATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007946.1-1103s1c1
Sequence:CCGGGCTCCGTAATAGGACCAACTTCTCGAGAAGTTGGTCCTATTACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007946.1-2146s1c1
Sequence:CCGGCTCGGATTGTATGCGACAATACTCGAGTATTGTCGCATACAATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007946.1-2133s1c1
Sequence:CCGGCGAATCTCTTTATCTCGGATTCTCGAGAATCCGAGATAAAGAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007946
EPX MISSION shRNA Lentiviral Transduction Particles
eosinophil peroxidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007946.1-2308s1c1
Sequence:CCGGCAAGCCTTGAAGATGAGGGTACTCGAGTACCCTCATCTTCAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007946.1-279s1c1
Sequence:CCGGGCCTACAATCACACACAGAAACTCGAGTTTCTGTGTGTGATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007946.1-1103s1c1
Sequence:CCGGGCTCCGTAATAGGACCAACTTCTCGAGAAGTTGGTCCTATTACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007946.1-2146s1c1
Sequence:CCGGCTCGGATTGTATGCGACAATACTCGAGTATTGTCGCATACAATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007946.1-2133s1c1
Sequence:CCGGCGAATCTCTTTATCTCGGATTCTCGAGAATCCGAGATAAAGAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks