EMAIL THIS PAGE TO A FRIEND

EPYC

epiphycan

57 Gene Product Result for
Synonyms: DSPG3 PGLB Pg-Lb SLRR3B
UniProtKB ID: Q99645, A8K3M7, Q8NEJ5
Gene ID:
Human(1833) Summary: Dermatan sulfate proteoglycan 3 is a member of the small leucine-rich repeat proteoglycan family. This gene is composed of seven exons. It regulates fibrillogenesis by interacting with collagen fibrils and other extracellular matrix proteins. [provided by RefSeq, Jul 2008]
Mouse(13516) epiphycan
Rat(314772) epiphycan
Zebrafish(550602) epiphycan
chicken(417890) epiphycan
cow(281747) epiphycan
dog(482597) epiphycan
sheep(101112468) epiphycan
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1427 Human DSPG3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004950 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004950 Rosetta Predictions human pricing
NM_001108088 Rosetta Predictions rat pricing
NM_007884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057113 predicted 912
2 SASI_Hs01_00057114 predicted 1018
3 SASI_Hs01_00057115 predicted 494
4 SASI_Hs01_00057116 predicted 513
5 SASI_Hs01_00057117 predicted 1138
6 SASI_Hs01_00057118 predicted 724
7 SASI_Hs02_00338626 predicted 937
8 SASI_Hs01_00057119 predicted 241
9 SASI_Hs02_00338627 predicted 1069
10 SASI_Hs01_00057121 predicted 954
11 SASI_Hs01_00057120 predicted 765
12 SASI_Hs01_00057122 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235234 predicted 762
2 SASI_Rn02_00235235 predicted 1167
3 SASI_Rn02_00235236 predicted 857
4 SASI_Rn02_00235237 predicted 615
5 SASI_Rn02_00235238 predicted 483
6 SASI_Rn02_00235239 predicted 1117
7 SASI_Rn02_00235240 predicted 650
8 SASI_Rn02_00235241 predicted 718
9 SASI_Rn02_00235242 predicted 1106
10 SASI_Rn02_00235243 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112592 predicted 1165
2 SASI_Mm01_00112593 predicted 747
3 SASI_Mm01_00112594 predicted 290
4 SASI_Mm01_00112595 predicted 195
5 SASI_Mm01_00112596 predicted 269
6 SASI_Mm01_00112597 predicted 477
7 SASI_Mm01_00112598 predicted 891
8 SASI_Mm01_00112599 predicted 853
9 SASI_Mm01_00112600 predicted 1088
10 SASI_Mm01_00112601 predicted 1105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004950
EPYC MISSION shRNA Bacterial Glycerol Stock
epiphycan
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-519s1c1
Sequence:CCGGCTGCCAAAGAACACCGCTTATCTCGAGATAAGCGGTGTTCTTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-917s1c1
Sequence:CCGGGCACGAAGATACGTTCTGCAACTCGAGTTGCAGAACGTATCTTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004950.2-202s1c1
Sequence:CCGGCCACCTTAGAAGACCTGGATACTCGAGTATCCAGGTCTTCTAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-969s1c1
Sequence:CCGGCTAGAGGACATTCGATTGGATCTCGAGATCCAATCGAATGTCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-801s1c1
Sequence:CCGGGACATGTATGATCTCCATCATCTCGAGATGATGGAGATCATACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150538    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004950.2-1158s1c1
Sequence:CCGGGATTGTGTTCTGAGAGATGATCTCGAGATCATCTCTCAGAACACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-725s1c1
Sequence:CCGGGCCAACCACTTCGACATTTATCTCGAGATAAATGTCGAAGTGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004950.4-581s21c1
Sequence:CCGGTTGCAAGCCTAAGTGATTTAACTCGAGTTAAATCACTTAGGCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004950.4-1079s21c1
Sequence:CCGGGCATTACGATGGCTACTATAACTCGAGTTATAGTAGCCATCGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004950.4-158s21c1
Sequence:CCGGCTCTAGAGTCCATCAACTATGCTCGAGCATAGTTGATGGACTCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004950
EPYC MISSION shRNA shRNA Plasmid DNA
epiphycan
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-519s1c1
Sequence:CCGGCTGCCAAAGAACACCGCTTATCTCGAGATAAGCGGTGTTCTTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-917s1c1
Sequence:CCGGGCACGAAGATACGTTCTGCAACTCGAGTTGCAGAACGTATCTTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004950.2-202s1c1
Sequence:CCGGCCACCTTAGAAGACCTGGATACTCGAGTATCCAGGTCTTCTAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-969s1c1
Sequence:CCGGCTAGAGGACATTCGATTGGATCTCGAGATCCAATCGAATGTCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-801s1c1
Sequence:CCGGGACATGTATGATCTCCATCATCTCGAGATGATGGAGATCATACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150538    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004950.2-1158s1c1
Sequence:CCGGGATTGTGTTCTGAGAGATGATCTCGAGATCATCTCTCAGAACACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-725s1c1
Sequence:CCGGGCCAACCACTTCGACATTTATCTCGAGATAAATGTCGAAGTGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004950.4-581s21c1
Sequence:CCGGTTGCAAGCCTAAGTGATTTAACTCGAGTTAAATCACTTAGGCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004950.4-1079s21c1
Sequence:CCGGGCATTACGATGGCTACTATAACTCGAGTTATAGTAGCCATCGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004950.4-158s21c1
Sequence:CCGGCTCTAGAGTCCATCAACTATGCTCGAGCATAGTTGATGGACTCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004950
EPYC MISSION shRNA Lentiviral Transduction Particles
epiphycan
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-519s1c1
Sequence:CCGGCTGCCAAAGAACACCGCTTATCTCGAGATAAGCGGTGTTCTTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-917s1c1
Sequence:CCGGGCACGAAGATACGTTCTGCAACTCGAGTTGCAGAACGTATCTTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004950.2-202s1c1
Sequence:CCGGCCACCTTAGAAGACCTGGATACTCGAGTATCCAGGTCTTCTAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-969s1c1
Sequence:CCGGCTAGAGGACATTCGATTGGATCTCGAGATCCAATCGAATGTCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-801s1c1
Sequence:CCGGGACATGTATGATCTCCATCATCTCGAGATGATGGAGATCATACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150538    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004950.2-1158s1c1
Sequence:CCGGGATTGTGTTCTGAGAGATGATCTCGAGATCATCTCTCAGAACACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004950.2-725s1c1
Sequence:CCGGGCCAACCACTTCGACATTTATCTCGAGATAAATGTCGAAGTGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004950.4-581s21c1
Sequence:CCGGTTGCAAGCCTAAGTGATTTAACTCGAGTTAAATCACTTAGGCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004950.4-1079s21c1
Sequence:CCGGGCATTACGATGGCTACTATAACTCGAGTTATAGTAGCCATCGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004950.4-158s21c1
Sequence:CCGGCTCTAGAGTCCATCAACTATGCTCGAGCATAGTTGATGGACTCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007884
EPYC MISSION shRNA Bacterial Glycerol Stock
epiphycan
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007884.2-1420s1c1
Sequence:CCGGGTTGCTAAGATGTAGACATTTCTCGAGAAATGTCTACATCTTAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007884.2-489s1c1
Sequence:CCGGCTTGTATAAGTACCACTGTATCTCGAGATACAGTGGTACTTATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007884.2-182s1c1
Sequence:CCGGGCACCAACTACAGAGCTCTTTCTCGAGAAAGAGCTCTGTAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007884.2-987s1c1
Sequence:CCGGGTAAGGCATTAGAGGATATTCCTCGAGGAATATCCTCTAATGCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007884.2-987s21c1
Sequence:CCGGGTAAGGCATTAGAGGATATTCCTCGAGGAATATCCTCTAATGCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007884.2-518s21c1
Sequence:CCGGGACCATGAACTGGACGCTATTCTCGAGAATAGCGTCCAGTTCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007884.2-1135s21c1
Sequence:CCGGGTAGCCAAGAGAAGCATATATCTCGAGATATATGCTTCTCTTGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007884.2-637s21c1
Sequence:CCGGGATCGATCTGACATCAAATTTCTCGAGAAATTTGATGTCAGATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007884.2-1093s21c1
Sequence:CCGGATGTTAGGATGCTAGGCAAATCTCGAGATTTGCCTAGCATCCTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007884
EPYC MISSION shRNA shRNA Plasmid DNA
epiphycan
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007884.2-1420s1c1
Sequence:CCGGGTTGCTAAGATGTAGACATTTCTCGAGAAATGTCTACATCTTAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007884.2-489s1c1
Sequence:CCGGCTTGTATAAGTACCACTGTATCTCGAGATACAGTGGTACTTATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007884.2-182s1c1
Sequence:CCGGGCACCAACTACAGAGCTCTTTCTCGAGAAAGAGCTCTGTAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007884.2-987s1c1
Sequence:CCGGGTAAGGCATTAGAGGATATTCCTCGAGGAATATCCTCTAATGCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007884.2-987s21c1
Sequence:CCGGGTAAGGCATTAGAGGATATTCCTCGAGGAATATCCTCTAATGCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007884.2-518s21c1
Sequence:CCGGGACCATGAACTGGACGCTATTCTCGAGAATAGCGTCCAGTTCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007884.2-1135s21c1
Sequence:CCGGGTAGCCAAGAGAAGCATATATCTCGAGATATATGCTTCTCTTGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007884.2-637s21c1
Sequence:CCGGGATCGATCTGACATCAAATTTCTCGAGAAATTTGATGTCAGATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007884.2-1093s21c1
Sequence:CCGGATGTTAGGATGCTAGGCAAATCTCGAGATTTGCCTAGCATCCTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007884
EPYC MISSION shRNA Lentiviral Transduction Particles
epiphycan
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007884.2-1420s1c1
Sequence:CCGGGTTGCTAAGATGTAGACATTTCTCGAGAAATGTCTACATCTTAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007884.2-489s1c1
Sequence:CCGGCTTGTATAAGTACCACTGTATCTCGAGATACAGTGGTACTTATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007884.2-182s1c1
Sequence:CCGGGCACCAACTACAGAGCTCTTTCTCGAGAAAGAGCTCTGTAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007884.2-987s1c1
Sequence:CCGGGTAAGGCATTAGAGGATATTCCTCGAGGAATATCCTCTAATGCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007884.2-987s21c1
Sequence:CCGGGTAAGGCATTAGAGGATATTCCTCGAGGAATATCCTCTAATGCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007884.2-518s21c1
Sequence:CCGGGACCATGAACTGGACGCTATTCTCGAGAATAGCGTCCAGTTCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007884.2-1135s21c1
Sequence:CCGGGTAGCCAAGAGAAGCATATATCTCGAGATATATGCTTCTCTTGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007884.2-637s21c1
Sequence:CCGGGATCGATCTGACATCAAATTTCTCGAGAAATTTGATGTCAGATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007884.2-1093s21c1
Sequence:CCGGATGTTAGGATGCTAGGCAAATCTCGAGATTTGCCTAGCATCCTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks