EMAIL THIS PAGE TO A FRIEND

EQTN

equatorin, sperm acrosome associated

71 Gene Product Result for
Synonyms: AFAF C9orf11 SPACA8 equatorin
UniProtKB ID: Q9NQ60, B2RPB3, B7ZMK1, Q5TCU1, Q96L22
Gene ID:
Mouse(67753) equatorin, sperm acrosome associated
Rat(500502) equatorin, sperm acrosome associated
domestic cat(101094055) equatorin, sperm acrosome associated
dog(611648) equatorin, sperm acrosome associated
cow(615968) equatorin, sperm acrosome associated
sheep(101106238) equatorin, sperm acrosome associated
domestic guinea pig(100713604) equatorin, sperm acrosome associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027089 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027089 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027089 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020641 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009641 MISSION® esiRNA esiRNA targeting human C9orf11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020641 Rosetta Predictions human pricing
NM_001039345 Rosetta Predictions rat pricing
NM_027089 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108641 predicted 229
2 SASI_Hs01_00108642 predicted 526
3 SASI_Hs01_00108643 predicted 511
4 SASI_Hs01_00108644 predicted 426
5 SASI_Hs01_00108645 predicted 527
6 SASI_Hs01_00108646 predicted 226
7 SASI_Hs01_00108647 predicted 516
8 SASI_Hs01_00108648 predicted 599
9 SASI_Hs01_00108649 predicted 309
10 SASI_Hs02_00353619 predicted 561
11 SASI_Hs01_00108650 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070560 predicted 557
2 SASI_Rn01_00070561 predicted 284
3 SASI_Rn02_00204833 predicted 521
4 SASI_Rn01_00070562 predicted 256
5 SASI_Rn01_00070564 predicted 640
6 SASI_Rn01_00070566 predicted 802
7 SASI_Rn01_00070567 predicted 362
8 SASI_Rn02_00204834 predicted 308
9 SASI_Rn01_00070568 predicted 406
10 SASI_Rn01_00070569 predicted 216
11 SASI_Rn01_00070563 predicted 282
12 SASI_Rn01_00070565 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032843 predicted 197
2 SASI_Mm01_00032844 predicted 262
3 SASI_Mm01_00032845 predicted 812
4 SASI_Mm01_00032846 predicted 530
5 SASI_Mm01_00032847 predicted 902
6 SASI_Mm01_00032849 predicted 382
7 SASI_Mm01_00032850 predicted 627
8 SASI_Mm01_00032851 predicted 295
9 SASI_Mm01_00032852 predicted 503
10 SASI_Mm02_00331517 predicted 534
11 SASI_Mm01_00032848 predicted 1006
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027089
EQTN MISSION shRNA Bacterial Glycerol Stock
equatorin, sperm acrosome associated
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.3-419s1c1
Sequence:CCGGCCTAGTGAATCCTCTCGTAAACTCGAGTTTACGAGAGGATTCACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.3-1059s1c1
Sequence:CCGGCACCGAGTAATTAACTATAAGCTCGAGCTTATAGTTAATTACTCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-84s1c1
Sequence:CCGGCCCAGACATTATCAGTCTACACTCGAGTGTAGACTGATAATGTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-325s1c1
Sequence:CCGGGCCACAACTAACCTGGAATTTCTCGAGAAATTCCAGGTTAGTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-336s1c1
Sequence:CCGGCCTGGAATTTGCTGTGAAGAACTCGAGTTCTTCACAGCAAATTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-731s1c1
Sequence:CCGGCTCTATCTTACTTCCATCCAACTCGAGTTGGATGGAAGTAAGATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-491s1c1
Sequence:CCGGGCATGGATGATAAAGATCAATCTCGAGATTGATCTTTATCATCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-136s1c1
Sequence:CCGGCTTTCAGATGAAGAACAGTATCTCGAGATACTGTTCTTCATCTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-346s1c1
Sequence:CCGGGCTGTGAAGAAGAACTATAAACTCGAGTTTATAGTTCTTCTTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-148s1c1
Sequence:CCGGGAACAGTATTATGCAGATGAACTCGAGTTCATCTGCATAATACTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-881s1c1
Sequence:CCGGGCTCCAATCAAACAGTCTTAACTCGAGTTAAGACTGTTTGATTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027089
EQTN MISSION shRNA shRNA Plasmid DNA
equatorin, sperm acrosome associated
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.3-419s1c1
Sequence:CCGGCCTAGTGAATCCTCTCGTAAACTCGAGTTTACGAGAGGATTCACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.3-1059s1c1
Sequence:CCGGCACCGAGTAATTAACTATAAGCTCGAGCTTATAGTTAATTACTCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-84s1c1
Sequence:CCGGCCCAGACATTATCAGTCTACACTCGAGTGTAGACTGATAATGTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-325s1c1
Sequence:CCGGGCCACAACTAACCTGGAATTTCTCGAGAAATTCCAGGTTAGTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-336s1c1
Sequence:CCGGCCTGGAATTTGCTGTGAAGAACTCGAGTTCTTCACAGCAAATTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-731s1c1
Sequence:CCGGCTCTATCTTACTTCCATCCAACTCGAGTTGGATGGAAGTAAGATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-491s1c1
Sequence:CCGGGCATGGATGATAAAGATCAATCTCGAGATTGATCTTTATCATCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-136s1c1
Sequence:CCGGCTTTCAGATGAAGAACAGTATCTCGAGATACTGTTCTTCATCTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-346s1c1
Sequence:CCGGGCTGTGAAGAAGAACTATAAACTCGAGTTTATAGTTCTTCTTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-148s1c1
Sequence:CCGGGAACAGTATTATGCAGATGAACTCGAGTTCATCTGCATAATACTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-881s1c1
Sequence:CCGGGCTCCAATCAAACAGTCTTAACTCGAGTTAAGACTGTTTGATTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027089
EQTN MISSION shRNA Lentiviral Transduction Particles
equatorin, sperm acrosome associated
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.3-419s1c1
Sequence:CCGGCCTAGTGAATCCTCTCGTAAACTCGAGTTTACGAGAGGATTCACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.3-1059s1c1
Sequence:CCGGCACCGAGTAATTAACTATAAGCTCGAGCTTATAGTTAATTACTCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-84s1c1
Sequence:CCGGCCCAGACATTATCAGTCTACACTCGAGTGTAGACTGATAATGTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-325s1c1
Sequence:CCGGGCCACAACTAACCTGGAATTTCTCGAGAAATTCCAGGTTAGTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-336s1c1
Sequence:CCGGCCTGGAATTTGCTGTGAAGAACTCGAGTTCTTCACAGCAAATTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-731s1c1
Sequence:CCGGCTCTATCTTACTTCCATCCAACTCGAGTTGGATGGAAGTAAGATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-491s1c1
Sequence:CCGGGCATGGATGATAAAGATCAATCTCGAGATTGATCTTTATCATCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-136s1c1
Sequence:CCGGCTTTCAGATGAAGAACAGTATCTCGAGATACTGTTCTTCATCTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-346s1c1
Sequence:CCGGGCTGTGAAGAAGAACTATAAACTCGAGTTTATAGTTCTTCTTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-148s1c1
Sequence:CCGGGAACAGTATTATGCAGATGAACTCGAGTTCATCTGCATAATACTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027089.1-881s1c1
Sequence:CCGGGCTCCAATCAAACAGTCTTAACTCGAGTTAAGACTGTTTGATTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020641
EQTN MISSION shRNA Bacterial Glycerol Stock
equatorin, sperm acrosome associated
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020641.1-763s1c1
Sequence:CCGGGCCACGATGTCTTACTTTCATCTCGAGATGAAAGTAAGACATCGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020641.1-788s1c1
Sequence:CCGGCAGAAGGTGTTTCAGATACATCTCGAGATGTATCTGAAACACCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-418s1c1
Sequence:CCGGGAAGAAACAACTACTAGCGAACTCGAGTTCGCTAGTAGTTGTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-161s1c1
Sequence:CCGGCATTGCCTAATGTGCTACCTTCTCGAGAAGGTAGCACATTAGGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-684s1c1
Sequence:CCGGCTGTAGTGCTACACTGTACAACTCGAGTTGTACAGTGTAGCACTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-848s1c1
Sequence:CCGGCCACTTCTTCAGATATGAGAACTCGAGTTCTCATATCTGAAGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-767s1c1
Sequence:CCGGCGATGTCTTACTTTCATCCATCTCGAGATGGATGAAAGTAAGACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020641
EQTN MISSION shRNA shRNA Plasmid DNA
equatorin, sperm acrosome associated
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020641.1-763s1c1
Sequence:CCGGGCCACGATGTCTTACTTTCATCTCGAGATGAAAGTAAGACATCGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020641.1-788s1c1
Sequence:CCGGCAGAAGGTGTTTCAGATACATCTCGAGATGTATCTGAAACACCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-418s1c1
Sequence:CCGGGAAGAAACAACTACTAGCGAACTCGAGTTCGCTAGTAGTTGTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-161s1c1
Sequence:CCGGCATTGCCTAATGTGCTACCTTCTCGAGAAGGTAGCACATTAGGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-684s1c1
Sequence:CCGGCTGTAGTGCTACACTGTACAACTCGAGTTGTACAGTGTAGCACTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-848s1c1
Sequence:CCGGCCACTTCTTCAGATATGAGAACTCGAGTTCTCATATCTGAAGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-767s1c1
Sequence:CCGGCGATGTCTTACTTTCATCCATCTCGAGATGGATGAAAGTAAGACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020641
EQTN MISSION shRNA Lentiviral Transduction Particles
equatorin, sperm acrosome associated
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020641.1-763s1c1
Sequence:CCGGGCCACGATGTCTTACTTTCATCTCGAGATGAAAGTAAGACATCGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020641.1-788s1c1
Sequence:CCGGCAGAAGGTGTTTCAGATACATCTCGAGATGTATCTGAAACACCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-418s1c1
Sequence:CCGGGAAGAAACAACTACTAGCGAACTCGAGTTCGCTAGTAGTTGTTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-161s1c1
Sequence:CCGGCATTGCCTAATGTGCTACCTTCTCGAGAAGGTAGCACATTAGGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-684s1c1
Sequence:CCGGCTGTAGTGCTACACTGTACAACTCGAGTTGTACAGTGTAGCACTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-848s1c1
Sequence:CCGGCCACTTCTTCAGATATGAGAACTCGAGTTCTCATATCTGAAGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020641.1-767s1c1
Sequence:CCGGCGATGTCTTACTTTCATCCATCTCGAGATGGATGAAAGTAAGACATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)