EMAIL THIS PAGE TO A FRIEND

ERAL1

Era-like 12S mitochondrial rRNA chaperone 1

62 Gene Product Result for
Synonyms: ERA ERAL1A H-ERA HERA-A HERA-B
Gene ID:
Mouse(57837) Era (G-protein)-like 1 (E. coli)
Rat(363646) Era-like 12S mitochondrial rRNA chaperone 1
Zebrafish(569087) Era G-protein-like 1 (E. coli)
dog(480629) Era G-protein-like 1 (E. coli)
domestic cat(101095450) Era G-protein-like 1 (E. coli)
cow(523344) Era G-protein-like 1 (E. coli)
chicken(374084) Era G-protein-like 1 (E. coli)
sheep(101108142) Era G-protein-like 1 (E. coli)
domestic guinea pig(100721797) Era-like 12S mitochondrial rRNA chaperone 1
naked mole-rat(101719291) Era-like 12S mitochondrial rRNA chaperone 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022313 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022313 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022313 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005702 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005702 Rosetta Predictions human pricing
NM_001013229 Rosetta Predictions rat pricing
NM_022313 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216814 predicted 422
2 SASI_Hs01_00216815 predicted 771
3 SASI_Hs01_00216816 predicted 586
4 SASI_Hs01_00216817 predicted 517
5 SASI_Hs01_00216818 predicted 590
6 SASI_Hs01_00216819 predicted 882
7 SASI_Hs02_00340108 predicted 626
8 SASI_Hs02_00340109 predicted 1055
9 SASI_Hs01_00216820 predicted 374
10 SASI_Hs01_00216821 predicted 441
11 SASI_Hs01_00216813 predicted 1065
12 SASI_Hs01_00216822 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013229 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056884 predicted 591
2 SASI_Rn02_00201042 predicted 414
3 SASI_Rn01_00056885 predicted 278
4 SASI_Rn01_00056886 predicted 1037
5 SASI_Rn01_00056887 predicted 580
6 SASI_Rn01_00056888 predicted 400
7 SASI_Rn01_00056889 predicted 764
8 SASI_Rn01_00056890 predicted 506
9 SASI_Rn01_00056891 predicted 1009
10 SASI_Rn01_00056892 predicted 933
11 SASI_Rn01_00056893 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109074 predicted 605
2 SASI_Mm02_00326535 predicted 972
3 SASI_Mm02_00326536 predicted 797
4 SASI_Mm02_00326537 predicted 966
5 SASI_Mm01_00109076 predicted 502
6 SASI_Mm02_00326538 predicted 423
7 SASI_Mm02_00326539 predicted 297
8 SASI_Mm01_00109078 predicted 958
9 SASI_Mm01_00109080 predicted 803
10 SASI_Mm01_00109081 predicted 1181
11 SASI_Mm01_00109073 predicted 940
12 SASI_Mm01_00109075 predicted 393
13 SASI_Mm01_00109077 predicted 1049
14 SASI_Mm01_00109079 predicted 578
15 SASI_Mm01_00109082 predicted 1030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022313
VALIDATED
ERAL1 MISSION shRNA Bacterial Glycerol Stock
Era-like 12S mitochondrial rRNA chaperone 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-1873s1c1
Sequence:CCGGGCTGGCTATCTCTACATAGATCTCGAGATCTATGTAGAGATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-581s1c1
Sequence:CCGGGCTGATCTTGTTGTAGTTCTTCTCGAGAAGAACTACAACAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-396s1c1
Sequence:CCGGGCCGTAAAGTGTTTCCTGTTTCTCGAGAAACAGGAAACACTTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-1024s1c1
Sequence:CCGGCGAAGAGATCTGTGCCAATAACTCGAGTTATTGGCACAGATCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-1282s1c1
Sequence:CCGGCCTCTCTGTGAAACTCCTCAACTCGAGTTGAGGAGTTTCACAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022313
VALIDATED
ERAL1 MISSION shRNA shRNA Plasmid DNA
Era-like 12S mitochondrial rRNA chaperone 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-1873s1c1
Sequence:CCGGGCTGGCTATCTCTACATAGATCTCGAGATCTATGTAGAGATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-581s1c1
Sequence:CCGGGCTGATCTTGTTGTAGTTCTTCTCGAGAAGAACTACAACAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-396s1c1
Sequence:CCGGGCCGTAAAGTGTTTCCTGTTTCTCGAGAAACAGGAAACACTTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-1024s1c1
Sequence:CCGGCGAAGAGATCTGTGCCAATAACTCGAGTTATTGGCACAGATCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-1282s1c1
Sequence:CCGGCCTCTCTGTGAAACTCCTCAACTCGAGTTGAGGAGTTTCACAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022313
VALIDATED
ERAL1 MISSION shRNA Lentiviral Transduction Particles
Era-like 12S mitochondrial rRNA chaperone 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-1873s1c1
Sequence:CCGGGCTGGCTATCTCTACATAGATCTCGAGATCTATGTAGAGATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-581s1c1
Sequence:CCGGGCTGATCTTGTTGTAGTTCTTCTCGAGAAGAACTACAACAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-396s1c1
Sequence:CCGGGCCGTAAAGTGTTTCCTGTTTCTCGAGAAACAGGAAACACTTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-1024s1c1
Sequence:CCGGCGAAGAGATCTGTGCCAATAACTCGAGTTATTGGCACAGATCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022313.1-1282s1c1
Sequence:CCGGCCTCTCTGTGAAACTCCTCAACTCGAGTTGAGGAGTTTCACAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005702
VALIDATED
ERAL1 MISSION shRNA Bacterial Glycerol Stock
Era-like 12S mitochondrial rRNA chaperone 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-1193s1c1
Sequence:CCGGCCCAAAGAATCTTATGTGAAACTCGAGTTTCACATAAGATTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-1693s1c1
Sequence:CCGGCCTCACTTCTTTCACCTTGAACTCGAGTTCAAGGTGAAAGAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-608s1c1
Sequence:CCGGGCTGATCTTGTTGTGGTTCTTCTCGAGAAGAACCACAACAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-1111s1c1
Sequence:CCGGGCCTTACAATGTACAGCAGAACTCGAGTTCTGCTGTACATTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-539s1c1
Sequence:CCGGCCTGGTAAACAGAAGAGGCATCTCGAGATGCCTCTTCTGTTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005702.2-599s21c1
Sequence:CCGGGCTGATCTTGTTGTGGTTCTTCTCGAGAAGAACCACAACAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005702.2-1184s21c1
Sequence:CCGGCCCAAAGAATCTTATGTGAAACTCGAGTTTCACATAAGATTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005702.2-1102s21c1
Sequence:CCGGGCCTTACAATGTACAGCAGAACTCGAGTTCTGCTGTACATTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005702.2-1684s21c1
Sequence:CCGGCCTCACTTCTTTCACCTTGAACTCGAGTTCAAGGTGAAAGAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005702
VALIDATED
ERAL1 MISSION shRNA shRNA Plasmid DNA
Era-like 12S mitochondrial rRNA chaperone 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-1193s1c1
Sequence:CCGGCCCAAAGAATCTTATGTGAAACTCGAGTTTCACATAAGATTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-1693s1c1
Sequence:CCGGCCTCACTTCTTTCACCTTGAACTCGAGTTCAAGGTGAAAGAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-608s1c1
Sequence:CCGGGCTGATCTTGTTGTGGTTCTTCTCGAGAAGAACCACAACAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-1111s1c1
Sequence:CCGGGCCTTACAATGTACAGCAGAACTCGAGTTCTGCTGTACATTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-539s1c1
Sequence:CCGGCCTGGTAAACAGAAGAGGCATCTCGAGATGCCTCTTCTGTTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005702.2-599s21c1
Sequence:CCGGGCTGATCTTGTTGTGGTTCTTCTCGAGAAGAACCACAACAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005702.2-1184s21c1
Sequence:CCGGCCCAAAGAATCTTATGTGAAACTCGAGTTTCACATAAGATTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005702.2-1102s21c1
Sequence:CCGGGCCTTACAATGTACAGCAGAACTCGAGTTCTGCTGTACATTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005702.2-1684s21c1
Sequence:CCGGCCTCACTTCTTTCACCTTGAACTCGAGTTCAAGGTGAAAGAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005702
VALIDATED
ERAL1 MISSION shRNA Lentiviral Transduction Particles
Era-like 12S mitochondrial rRNA chaperone 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-1193s1c1
Sequence:CCGGCCCAAAGAATCTTATGTGAAACTCGAGTTTCACATAAGATTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-1693s1c1
Sequence:CCGGCCTCACTTCTTTCACCTTGAACTCGAGTTCAAGGTGAAAGAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-608s1c1
Sequence:CCGGGCTGATCTTGTTGTGGTTCTTCTCGAGAAGAACCACAACAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-1111s1c1
Sequence:CCGGGCCTTACAATGTACAGCAGAACTCGAGTTCTGCTGTACATTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005702.1-539s1c1
Sequence:CCGGCCTGGTAAACAGAAGAGGCATCTCGAGATGCCTCTTCTGTTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005702.2-599s21c1
Sequence:CCGGGCTGATCTTGTTGTGGTTCTTCTCGAGAAGAACCACAACAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005702.2-1184s21c1
Sequence:CCGGCCCAAAGAATCTTATGTGAAACTCGAGTTTCACATAAGATTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005702.2-1102s21c1
Sequence:CCGGGCCTTACAATGTACAGCAGAACTCGAGTTCTGCTGTACATTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005702.2-1684s21c1
Sequence:CCGGCCTCACTTCTTTCACCTTGAACTCGAGTTCAAGGTGAAAGAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks