EMAIL THIS PAGE TO A FRIEND

ERAP1

endoplasmic reticulum aminopeptidase 1

114 Gene Product Result for
Synonyms: A-LAP ALAP APPILS ARTS-1 ARTS1 ERAAP ERAAP1 PILS-AP PILSAP
Gene ID:
Human(51752) Summary: The protein encoded by this gene is an aminopeptidase involved in trimming HLA class I-binding precursors so that they can be presented on MHC class I molecules. The encoded protein acts as a monomer or as a heterodimer with ERAP2. This protein may also be involved in blood pressure regulation by inactivation of angiotensin II. Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
Mouse(80898) endoplasmic reticulum aminopeptidase 1
Rat(80897) endoplasmic reticulum aminopeptidase 1
naked mole-rat(101706813) endoplasmic reticulum aminopeptidase 1
domestic guinea pig(100724993) endoplasmic reticulum aminopeptidase 1
sheep(101110506) endoplasmic reticulum aminopeptidase 1
Domestic Rabbit(100352256) endoplasmic reticulum aminopeptidase 1
chicken(427122) endoplasmic reticulum aminopeptidase 1
dog(488898) endoplasmic reticulum aminopeptidase 1
domestic cat(101083063) endoplasmic reticulum aminopeptidase 1
cow(514617) endoplasmic reticulum aminopeptidase 1
Horse(100073224) endoplasmic reticulum aminopeptidase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003021 MISSION® esiRNA esiRNA targeting human ARTS-1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040458 Rosetta Predictions human pricing
NM_016442 Rosetta Predictions human pricing
NM_030836 Rosetta Predictions rat pricing
NM_030711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188011 predicted 1777
2 SASI_Hs02_00309002 predicted 1621
3 SASI_Hs01_00188012 predicted 1070
4 SASI_Hs01_00188013 predicted 1132
5 SASI_Hs01_00188014 predicted 861
6 SASI_Hs01_00188015 predicted 2237
7 SASI_Hs01_00188016 predicted 2154
8 SASI_Hs01_00188018 predicted 1329
9 SASI_Hs01_00188019 predicted 614
10 SASI_Hs01_00188020 predicted 1565
11 SASI_Hs01_00188017 predicted 1478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086140 predicted 1781
2 SASI_Hs02_00349475 predicted 1619
3 SASI_Hs01_00086141 predicted 1069
4 SASI_Hs01_00086142 predicted 1134
5 SASI_Hs01_00086143 predicted 855
6 SASI_Hs01_00086144 predicted 2237
7 SASI_Hs01_00086145 predicted 2145
8 SASI_Hs01_00086147 predicted 1329
9 SASI_Hs01_00086148 predicted 618
10 SASI_Hs01_00086149 predicted 1561
11 SASI_Hs01_00086146 predicted 1475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070617 predicted 1238
2 SASI_Rn01_00070619 predicted 1315
3 SASI_Rn01_00070620 predicted 1569
4 SASI_Rn02_00264058 predicted 2022
5 SASI_Rn01_00070621 predicted 2063
6 SASI_Rn01_00070623 predicted 2780
7 SASI_Rn02_00264059 predicted 1826
8 SASI_Rn01_00070625 predicted 2240
9 SASI_Rn01_00070626 predicted 932
10 SASI_Rn02_00264060 predicted 2738
11 SASI_Rn01_00070618 predicted 1927
12 SASI_Rn01_00070622 predicted 911
13 SASI_Rn01_00070624 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182621 predicted 1253
2 SASI_Mm01_00182623 predicted 1069
3 SASI_Mm01_00182624 predicted 1420
4 SASI_Mm01_00182625 predicted 2078
5 SASI_Mm01_00182626 predicted 1147
6 SASI_Mm01_00182627 predicted 2165
7 SASI_Mm01_00182628 predicted 1535
8 SASI_Mm02_00336895 predicted 2317
9 SASI_Mm01_00182629 predicted 875
10 SASI_Mm02_00336896 predicted 1847
11 SASI_Mm01_00182620 predicted 1337
12 SASI_Mm01_00182622 predicted 1940
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016442
ERAP1 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum aminopeptidase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016442.3-3259s21c1
Sequence:CCGGAGCATAGCTGACTTCGCTAAACTCGAGTTTAGCGAAGTCAGCTATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016442.3-1783s21c1
Sequence:CCGGGGGATAGTATGGCAAGTATTTCTCGAGAAATACTTGCCATACTATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016442.3-1700s21c1
Sequence:CCGGTCTTAGTGCTGACGCATTTAACTCGAGTTAAATGCGTCAGCACTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016442.2-2003s1c1
Sequence:CCGGCGGGCAAGTCTCATTAACAATCTCGAGATTGTTAATGAGACTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016442.2-1088s1c1
Sequence:CCGGGCTCTGTTGTTTGATGCAGAACTCGAGTTCTGCATCAAACAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016442.2-150s1c1
Sequence:CCGGCCTCACTGTTGGCTCTCTTAACTCGAGTTAAGAGAGCCAACAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016442.2-2712s1c1
Sequence:CCGGCCCACATGGTAATGGGTACAACTCGAGTTGTACCCATTACCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016442
ERAP1 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum aminopeptidase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016442.3-3259s21c1
Sequence:CCGGAGCATAGCTGACTTCGCTAAACTCGAGTTTAGCGAAGTCAGCTATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016442.3-1783s21c1
Sequence:CCGGGGGATAGTATGGCAAGTATTTCTCGAGAAATACTTGCCATACTATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016442.3-1700s21c1
Sequence:CCGGTCTTAGTGCTGACGCATTTAACTCGAGTTAAATGCGTCAGCACTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016442.2-2003s1c1
Sequence:CCGGCGGGCAAGTCTCATTAACAATCTCGAGATTGTTAATGAGACTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016442.2-1088s1c1
Sequence:CCGGGCTCTGTTGTTTGATGCAGAACTCGAGTTCTGCATCAAACAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016442.2-150s1c1
Sequence:CCGGCCTCACTGTTGGCTCTCTTAACTCGAGTTAAGAGAGCCAACAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016442.2-2712s1c1
Sequence:CCGGCCCACATGGTAATGGGTACAACTCGAGTTGTACCCATTACCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016442
ERAP1 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum aminopeptidase 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016442.3-3259s21c1
Sequence:CCGGAGCATAGCTGACTTCGCTAAACTCGAGTTTAGCGAAGTCAGCTATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016442.3-1783s21c1
Sequence:CCGGGGGATAGTATGGCAAGTATTTCTCGAGAAATACTTGCCATACTATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016442.3-1700s21c1
Sequence:CCGGTCTTAGTGCTGACGCATTTAACTCGAGTTAAATGCGTCAGCACTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016442.2-2003s1c1
Sequence:CCGGCGGGCAAGTCTCATTAACAATCTCGAGATTGTTAATGAGACTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016442.2-1088s1c1
Sequence:CCGGGCTCTGTTGTTTGATGCAGAACTCGAGTTCTGCATCAAACAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016442.2-150s1c1
Sequence:CCGGCCTCACTGTTGGCTCTCTTAACTCGAGTTAAGAGAGCCAACAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016442.2-2712s1c1
Sequence:CCGGCCCACATGGTAATGGGTACAACTCGAGTTGTACCCATTACCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030711
VALIDATED
ERAP1 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum aminopeptidase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030711.4-3277s21c1
Sequence:CCGGTGCCTTGCAGGATCCACTTAACTCGAGTTAAGTGGATCCTGCAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030711.4-2242s21c1
Sequence:CCGGCTCGCATGTGTGCGCAATTATCTCGAGATAATTGCGCACACATGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030711.4-2648s21c1
Sequence:CCGGCGTCCATAGCTCACATGGTAACTCGAGTTACCATGTGAGCTATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030711.4-1366s21c1
Sequence:CCGGGCTTGTATTCTGAATATGCTACTCGAGTAGCATATTCAGAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030711.4-1845s21c1
Sequence:CCGGCGTGGGAATGAATGGCTATTACTCGAGTAATAGCCATTCATTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030711.2-1846s1c1
Sequence:CCGGCGTGGGAATGAATGGCTATTACTCGAGTAATAGCCATTCATTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030711.2-185s1c1
Sequence:CCGGCCTTGGAATAATATGCGACTTCTCGAGAAGTCGCATATTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030711.2-2287s1c1
Sequence:CCGGGCGCTATTTCAGAGAGTGGAACTCGAGTTCCACTCTCTGAAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030711.2-2649s1c1
Sequence:CCGGCGTCCATAGCTCACATGGTAACTCGAGTTACCATGTGAGCTATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030711.2-1367s1c1
Sequence:CCGGGCTTGTATTCTGAATATGCTACTCGAGTAGCATATTCAGAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030711
VALIDATED
ERAP1 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum aminopeptidase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030711.4-3277s21c1
Sequence:CCGGTGCCTTGCAGGATCCACTTAACTCGAGTTAAGTGGATCCTGCAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030711.4-2242s21c1
Sequence:CCGGCTCGCATGTGTGCGCAATTATCTCGAGATAATTGCGCACACATGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030711.4-2648s21c1
Sequence:CCGGCGTCCATAGCTCACATGGTAACTCGAGTTACCATGTGAGCTATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030711.4-1366s21c1
Sequence:CCGGGCTTGTATTCTGAATATGCTACTCGAGTAGCATATTCAGAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030711.4-1845s21c1
Sequence:CCGGCGTGGGAATGAATGGCTATTACTCGAGTAATAGCCATTCATTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030711.2-1846s1c1
Sequence:CCGGCGTGGGAATGAATGGCTATTACTCGAGTAATAGCCATTCATTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030711.2-185s1c1
Sequence:CCGGCCTTGGAATAATATGCGACTTCTCGAGAAGTCGCATATTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030711.2-2287s1c1
Sequence:CCGGGCGCTATTTCAGAGAGTGGAACTCGAGTTCCACTCTCTGAAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030711.2-2649s1c1
Sequence:CCGGCGTCCATAGCTCACATGGTAACTCGAGTTACCATGTGAGCTATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030711.2-1367s1c1
Sequence:CCGGGCTTGTATTCTGAATATGCTACTCGAGTAGCATATTCAGAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030711
VALIDATED
ERAP1 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum aminopeptidase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030711.4-3277s21c1
Sequence:CCGGTGCCTTGCAGGATCCACTTAACTCGAGTTAAGTGGATCCTGCAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030711.4-2242s21c1
Sequence:CCGGCTCGCATGTGTGCGCAATTATCTCGAGATAATTGCGCACACATGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030711.4-2648s21c1
Sequence:CCGGCGTCCATAGCTCACATGGTAACTCGAGTTACCATGTGAGCTATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030711.4-1366s21c1
Sequence:CCGGGCTTGTATTCTGAATATGCTACTCGAGTAGCATATTCAGAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030711.4-1845s21c1
Sequence:CCGGCGTGGGAATGAATGGCTATTACTCGAGTAATAGCCATTCATTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030711.2-1846s1c1
Sequence:CCGGCGTGGGAATGAATGGCTATTACTCGAGTAATAGCCATTCATTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030711.2-185s1c1
Sequence:CCGGCCTTGGAATAATATGCGACTTCTCGAGAAGTCGCATATTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030711.2-2287s1c1
Sequence:CCGGGCGCTATTTCAGAGAGTGGAACTCGAGTTCCACTCTCTGAAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030711.2-2649s1c1
Sequence:CCGGCGTCCATAGCTCACATGGTAACTCGAGTTACCATGTGAGCTATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030711.2-1367s1c1
Sequence:CCGGGCTTGTATTCTGAATATGCTACTCGAGTAGCATATTCAGAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks