EMAIL THIS PAGE TO A FRIEND

ERAP2

endoplasmic reticulum aminopeptidase 2

25 Gene Product Result for
Synonyms: L-RAP LRAP
UniProtKB ID: Q6P179, Q7Z5K1, Q8TD32, Q8WVJ4, Q9HBX2
Gene ID:
Human(64167) Summary: Aminopeptidases hydrolyze N-terminal amino acids of proteins or peptide substrates. Major histocompatibility complex (MHC) class I molecules rely on aminopeptidases such as ERAP1 (MIM 606832) and LRAP to trim precursors to antigenic peptides in the endoplasmic reticulum (ER) following cleavage in the cytoplasm by tripeptidyl peptidase II (TPP2; MIM 190470) (Tanioka et al., 2003 [PubMed 12799365]
Zebrafish(100144556) endoplasmic reticulum aminopeptidase 2
dog(488897) endoplasmic reticulum aminopeptidase 2
cow(513572) endoplasmic reticulum aminopeptidase 2
domestic cat(101089239) endoplasmic reticulum aminopeptidase 2
sheep(101102484) endoplasmic reticulum aminopeptidase 2
domestic guinea pig(100719006) endoplasmic reticulum aminopeptidase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022350 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150601 MISSION® esiRNA esiRNA human LRAP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022350 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076179 predicted 1871
2 SASI_Hs01_00076180 predicted 1346
3 SASI_Hs01_00076181 predicted 1139
4 SASI_Hs01_00076182 predicted 2635
5 SASI_Hs01_00076183 predicted 245
6 SASI_Hs01_00076185 predicted 1000
7 SASI_Hs01_00076186 predicted 1321
8 SASI_Hs01_00076187 predicted 745
9 SASI_Hs01_00076188 predicted 2032
10 SASI_Hs02_00355643 predicted 1008
11 SASI_Hs01_00076184 predicted 1276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022350
ERAP2 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum aminopeptidase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022350.1-1077s1c1
Sequence:CCGGCCACTCTCCAAACTGGATTTACTCGAGTAAATCCAGTTTGGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022350.1-1350s1c1
Sequence:CCGGGAGCTGCAATTTGATGACTATCTCGAGATAGTCATCAAATTGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022350.1-762s1c1
Sequence:CCGGCCGTTGTTCAAAGCCAACTTTCTCGAGAAAGTTGGCTTTGAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022350.1-1448s1c1
Sequence:CCGGCCCGACTCAAATACAGGAAATCTCGAGATTTCCTGTATTTGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022350.3-3567s21c1
Sequence:CCGGAGGACTTGGCTAATGGTTAATCTCGAGATTAACCATTAGCCAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022350.3-1772s21c1
Sequence:CCGGGACCTCTTCTGCTTCCGATAACTCGAGTTATCGGAAGCAGAAGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022350.1-3044s1c2
Sequence:CCGGCGCCTGTAATCCCAGCACTTTCTCGAGAAAGTGCTGGGATTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022350.3-2879s21c1
Sequence:CCGGGCGTTACCTTCTTCAGTATTTCTCGAGAAATACTGAAGAAGGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022350
ERAP2 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum aminopeptidase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022350.1-1077s1c1
Sequence:CCGGCCACTCTCCAAACTGGATTTACTCGAGTAAATCCAGTTTGGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022350.1-1350s1c1
Sequence:CCGGGAGCTGCAATTTGATGACTATCTCGAGATAGTCATCAAATTGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022350.1-762s1c1
Sequence:CCGGCCGTTGTTCAAAGCCAACTTTCTCGAGAAAGTTGGCTTTGAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022350.1-1448s1c1
Sequence:CCGGCCCGACTCAAATACAGGAAATCTCGAGATTTCCTGTATTTGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022350.3-3567s21c1
Sequence:CCGGAGGACTTGGCTAATGGTTAATCTCGAGATTAACCATTAGCCAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022350.3-1772s21c1
Sequence:CCGGGACCTCTTCTGCTTCCGATAACTCGAGTTATCGGAAGCAGAAGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022350.1-3044s1c2
Sequence:CCGGCGCCTGTAATCCCAGCACTTTCTCGAGAAAGTGCTGGGATTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022350.3-2879s21c1
Sequence:CCGGGCGTTACCTTCTTCAGTATTTCTCGAGAAATACTGAAGAAGGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022350
ERAP2 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum aminopeptidase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022350.1-1077s1c1
Sequence:CCGGCCACTCTCCAAACTGGATTTACTCGAGTAAATCCAGTTTGGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022350.1-1350s1c1
Sequence:CCGGGAGCTGCAATTTGATGACTATCTCGAGATAGTCATCAAATTGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022350.1-762s1c1
Sequence:CCGGCCGTTGTTCAAAGCCAACTTTCTCGAGAAAGTTGGCTTTGAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022350.1-1448s1c1
Sequence:CCGGCCCGACTCAAATACAGGAAATCTCGAGATTTCCTGTATTTGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022350.3-3567s21c1
Sequence:CCGGAGGACTTGGCTAATGGTTAATCTCGAGATTAACCATTAGCCAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022350.3-1772s21c1
Sequence:CCGGGACCTCTTCTGCTTCCGATAACTCGAGTTATCGGAAGCAGAAGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022350.1-3044s1c2
Sequence:CCGGCGCCTGTAATCCCAGCACTTTCTCGAGAAAGTGCTGGGATTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022350.3-2879s21c1
Sequence:CCGGGCGTTACCTTCTTCAGTATTTCTCGAGAAATACTGAAGAAGGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks