EMAIL THIS PAGE TO A FRIEND

ERAS

ES cell expressed Ras

72 Gene Product Result for
Synonyms: HRAS2 HRASP
UniProtKB ID: Q7Z444
Gene ID:
Human(3266) Summary: This gene encodes a constitutively active member of the small GTPase Ras protein family. The encoded protein activates the phosphatidylinositol 3-kinase signal transduction pathway in undifferentiated stem cells, but is not expressed in differentiated cells. This gene may be involved in cancer and chemotherapy resistance. [provided by RefSeq, Dec 2012]
Mouse(353283) ES cell-expressed Ras
Rat(679682) ES cell expressed Ras
sheep(101108988) ES cell expressed Ras
domestic guinea pig(100718270) ES cell expressed Ras
naked mole-rat(101708792) ES cell expressed Ras
cow(540065) ES cell expressed Ras
domestic cat(101096449) ES cell expressed Ras
dog(491869) ES cell expressed Ras
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181532 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181548 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181548 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181548 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039701 MISSION® esiRNA esiRNA human ERAS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181532 Rosetta Predictions human pricing
NM_001109375 Rosetta Predictions rat pricing
NM_181548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234976 predicted 991
2 SASI_Hs02_00370148 predicted 987
3 SASI_Hs01_00234977 predicted 1018
4 SASI_Hs01_00234978 predicted 952
5 SASI_Hs01_00234979 predicted 884
6 SASI_Hs01_00234982 predicted 420
7 SASI_Hs02_00370149 predicted 1022
8 SASI_Hs01_00234983 predicted 1020
9 SASI_Hs01_00234984 predicted 698
10 SASI_Hs01_00234985 predicted 708
11 SASI_Hs01_00234980 predicted 564
12 SASI_Hs01_00234981 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247796 predicted 785
2 SASI_Rn02_00247797 predicted 426
3 SASI_Rn02_00247798 predicted 718
4 SASI_Rn02_00247799 predicted 751
5 SASI_Rn02_00247800 predicted 788
6 SASI_Rn02_00247801 predicted 666
7 SASI_Rn02_00247802 predicted 607
8 SASI_Rn02_00247803 predicted 725
9 SASI_Rn02_00247804 predicted 426
10 SASI_Rn02_00247805 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052692 predicted 459
2 SASI_Mm01_00052693 predicted 425
3 SASI_Mm01_00052694 predicted 313
4 SASI_Mm01_00052695 predicted 246
5 SASI_Mm01_00052696 predicted 440
6 SASI_Mm01_00052697 predicted 432
7 SASI_Mm01_00052698 predicted 592
8 SASI_Mm01_00052699 predicted 567
9 SASI_Mm01_00052700 predicted 431
10 SASI_Mm01_00052701 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181532
ERAS MISSION shRNA Bacterial Glycerol Stock
ES cell expressed Ras
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181532.2-467s21c1
Sequence:CCGGCACCATCCAGGATTCCTACTGCTCGAGCAGTAGGAATCCTGGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181532.2-634s21c1
Sequence:CCGGTGATCCAGCTGCAGCAGATATCTCGAGATATCTGCTGCAGCTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181532.2-886s21c1
Sequence:CCGGCAAGGTCCTGTAGGGAGAAGACTCGAGTCTTCTCCCTACAGGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181532.2-1036s21c1
Sequence:CCGGTGAGGGACACATCAGGTATACCTCGAGGTATACCTGATGTGTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181532.2-827s21c1
Sequence:CCGGTTCCCTGCTGGTCCATGAGATCTCGAGATCTCATGGACCAGCAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181532.2-700s1c1
Sequence:CCGGGCAACAAGTGTGACCTTGTGACTCGAGTCACAAGGTCACACTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181532.2-886s1c1
Sequence:CCGGCAAGGTCCTGTAGGGAGAAGACTCGAGTCTTCTCCCTACAGGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181532.2-989s1c1
Sequence:CCGGCCAGGGTGATTGTTCATTTGACTCGAGTCAAATGAACAATCACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181532.2-365s1c1
Sequence:CCGGGCTGCCTGAGTACAAGGCTGTCTCGAGACAGCCTTGTACTCAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181532.2-470s1c1
Sequence:CCGGCATCCAGGATTCCTACTGGAACTCGAGTTCCAGTAGGAATCCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181532
ERAS MISSION shRNA shRNA Plasmid DNA
ES cell expressed Ras
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181532.2-467s21c1
Sequence:CCGGCACCATCCAGGATTCCTACTGCTCGAGCAGTAGGAATCCTGGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181532.2-634s21c1
Sequence:CCGGTGATCCAGCTGCAGCAGATATCTCGAGATATCTGCTGCAGCTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181532.2-886s21c1
Sequence:CCGGCAAGGTCCTGTAGGGAGAAGACTCGAGTCTTCTCCCTACAGGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181532.2-1036s21c1
Sequence:CCGGTGAGGGACACATCAGGTATACCTCGAGGTATACCTGATGTGTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181532.2-827s21c1
Sequence:CCGGTTCCCTGCTGGTCCATGAGATCTCGAGATCTCATGGACCAGCAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181532.2-700s1c1
Sequence:CCGGGCAACAAGTGTGACCTTGTGACTCGAGTCACAAGGTCACACTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181532.2-886s1c1
Sequence:CCGGCAAGGTCCTGTAGGGAGAAGACTCGAGTCTTCTCCCTACAGGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181532.2-989s1c1
Sequence:CCGGCCAGGGTGATTGTTCATTTGACTCGAGTCAAATGAACAATCACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181532.2-365s1c1
Sequence:CCGGGCTGCCTGAGTACAAGGCTGTCTCGAGACAGCCTTGTACTCAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181532.2-470s1c1
Sequence:CCGGCATCCAGGATTCCTACTGGAACTCGAGTTCCAGTAGGAATCCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181532
ERAS MISSION shRNA Lentiviral Transduction Particles
ES cell expressed Ras
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181532.2-467s21c1
Sequence:CCGGCACCATCCAGGATTCCTACTGCTCGAGCAGTAGGAATCCTGGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181532.2-634s21c1
Sequence:CCGGTGATCCAGCTGCAGCAGATATCTCGAGATATCTGCTGCAGCTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181532.2-886s21c1
Sequence:CCGGCAAGGTCCTGTAGGGAGAAGACTCGAGTCTTCTCCCTACAGGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181532.2-1036s21c1
Sequence:CCGGTGAGGGACACATCAGGTATACCTCGAGGTATACCTGATGTGTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181532.2-827s21c1
Sequence:CCGGTTCCCTGCTGGTCCATGAGATCTCGAGATCTCATGGACCAGCAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181532.2-700s1c1
Sequence:CCGGGCAACAAGTGTGACCTTGTGACTCGAGTCACAAGGTCACACTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181532.2-886s1c1
Sequence:CCGGCAAGGTCCTGTAGGGAGAAGACTCGAGTCTTCTCCCTACAGGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181532.2-989s1c1
Sequence:CCGGCCAGGGTGATTGTTCATTTGACTCGAGTCAAATGAACAATCACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181532.2-365s1c1
Sequence:CCGGGCTGCCTGAGTACAAGGCTGTCTCGAGACAGCCTTGTACTCAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181532.2-470s1c1
Sequence:CCGGCATCCAGGATTCCTACTGGAACTCGAGTTCCAGTAGGAATCCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181548
ERAS MISSION shRNA Bacterial Glycerol Stock
ES cell expressed Ras
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181548.2-792s1c2
Sequence:CCGGTGTGGCCGAATCAAGCAAGAACTCGAGTTCTTGCTTGATTCGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181548.2-889s1c1
Sequence:CCGGGTCTCATGTCAAGGTGACAATCTCGAGATTGTCACCTTGACATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181548.2-259s1c1
Sequence:CCGGGCTTGGGCACAGTGCAAAGATCTCGAGATCTTTGCACTGTGCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181548.2-360s1c1
Sequence:CCGGGACTCACCAATGCTTCGTGAACTCGAGTTCACGAAGCATTGGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181548.2-435s1c1
Sequence:CCGGCGGAGGCTACATTCTAAATGTCTCGAGACATTTAGAATGTAGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181548.2-561s21c1
Sequence:CCGGGGACCAGTTGCAGCAGATATGCTCGAGCATATCTGCTGCAACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181548
ERAS MISSION shRNA shRNA Plasmid DNA
ES cell expressed Ras
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181548.2-792s1c2
Sequence:CCGGTGTGGCCGAATCAAGCAAGAACTCGAGTTCTTGCTTGATTCGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181548.2-889s1c1
Sequence:CCGGGTCTCATGTCAAGGTGACAATCTCGAGATTGTCACCTTGACATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181548.2-259s1c1
Sequence:CCGGGCTTGGGCACAGTGCAAAGATCTCGAGATCTTTGCACTGTGCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181548.2-360s1c1
Sequence:CCGGGACTCACCAATGCTTCGTGAACTCGAGTTCACGAAGCATTGGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181548.2-435s1c1
Sequence:CCGGCGGAGGCTACATTCTAAATGTCTCGAGACATTTAGAATGTAGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181548.2-561s21c1
Sequence:CCGGGGACCAGTTGCAGCAGATATGCTCGAGCATATCTGCTGCAACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181548
ERAS MISSION shRNA Lentiviral Transduction Particles
ES cell expressed Ras
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181548.2-792s1c2
Sequence:CCGGTGTGGCCGAATCAAGCAAGAACTCGAGTTCTTGCTTGATTCGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181548.2-889s1c1
Sequence:CCGGGTCTCATGTCAAGGTGACAATCTCGAGATTGTCACCTTGACATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181548.2-259s1c1
Sequence:CCGGGCTTGGGCACAGTGCAAAGATCTCGAGATCTTTGCACTGTGCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181548.2-360s1c1
Sequence:CCGGGACTCACCAATGCTTCGTGAACTCGAGTTCACGAAGCATTGGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181548.2-435s1c1
Sequence:CCGGCGGAGGCTACATTCTAAATGTCTCGAGACATTTAGAATGTAGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181548.2-561s21c1
Sequence:CCGGGGACCAGTTGCAGCAGATATGCTCGAGCATATCTGCTGCAACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks