EMAIL THIS PAGE TO A FRIEND

ERBB2IP

erbb2 interacting protein

224 Gene Product Result for
Synonyms: ERBIN LAP2
Gene ID:
Human(55914) Summary: This gene is a member of the leucine-rich repeat and PDZ domain (LAP) family. The encoded protein contains 17 leucine-rich repeats and one PDZ domain. It binds to the unphosphorylated form of the ERBB2 protein and regulates ERBB2 function and localization. It has also been shown to affect the Ras signaling pathway by disrupting Ras-Raf interaction. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(59079) Erbb2 interacting protein
Rat(365662) erbb2 interacting protein
Zebrafish(566811) erbb2 interacting protein
chicken(431583) erbb2 interacting protein
Horse(100057128) erbb2 interacting protein
cow(512866) erbb2 interacting protein
domestic cat(101083061) erbb2 interacting protein
dog(478082) erbb2 interacting protein
domestic guinea pig(100728761) erbb2 interacting protein
naked mole-rat(101709350) erbb2 interacting protein
sheep(101123325) erbb2 interacting protein
Domestic Rabbit(100357586) erbb2 interacting protein
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018695 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006600 Rosetta Predictions human pricing
NM_018695 Rosetta Predictions human pricing
XM_345148 Rosetta Predictions rat pricing
NM_001005868 Rosetta Predictions mouse pricing
NM_021563 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042792 predicted 2956
2 SASI_Hs01_00042793 predicted 374
3 SASI_Hs01_00042794 predicted 2523
4 SASI_Hs01_00042795 predicted 3371
5 SASI_Hs01_00042796 predicted 3517
6 SASI_Hs01_00042797 predicted 2803
7 SASI_Hs01_00042798 predicted 606
8 SASI_Hs01_00042800 predicted 1183
9 SASI_Hs01_00042801 predicted 2742
10 SASI_Hs02_00305069 predicted 2004
11 SASI_Hs01_00042799 predicted 3209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189428 predicted 2955
2 SASI_Hs01_00189429 predicted 374
3 SASI_Hs01_00189430 predicted 2520
4 SASI_Hs01_00189431 predicted 3364
5 SASI_Hs01_00189432 predicted 3518
6 SASI_Hs01_00189433 predicted 2804
7 SASI_Hs01_00189434 predicted 604
8 SASI_Hs01_00189436 predicted 1184
9 SASI_Hs01_00189437 predicted 2745
10 SASI_Hs02_00352220 predicted 2004
11 SASI_Hs01_00189435 predicted 3202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172780 predicted 283
2 SASI_Rn01_00172781 predicted 242
3 SASI_Rn01_00172782 predicted 235
4 SASI_Rn01_00172783 predicted 282
5 SASI_Rn01_00172784 predicted 270
6 SASI_Rn01_00172785 predicted 261
7 SASI_Rn01_00172786 predicted 251
8 SASI_Rn01_00172787 predicted 239
9 SASI_Rn01_00172788 predicted 267
10 SASI_Rn01_00172789 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151189 predicted 1194
2 SASI_Mm01_00151192 predicted 2153
3 SASI_Mm01_00151193 predicted 3291
4 SASI_Mm02_00286689 predicted 1897
5 SASI_Mm02_00286690 predicted 3757
6 SASI_Mm01_00151195 predicted 2568
7 SASI_Mm01_00151196 predicted 1004
8 SASI_Mm01_00151197 predicted 464
9 SASI_Mm02_00286691 predicted 4156
10 SASI_Mm02_00286692 predicted 392
11 SASI_Mm01_00151190 predicted 1632
12 SASI_Mm01_00151191 predicted 1279
13 SASI_Mm01_00151194 predicted 1830
14 SASI_Mm01_00151198 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029530 predicted 1197
2 SASI_Mm01_00029531 predicted 1626
3 SASI_Mm01_00029532 predicted 1269
4 SASI_Mm01_00029533 predicted 2150
5 SASI_Mm01_00029534 predicted 3295
6 SASI_Mm02_00326346 predicted 1891
7 SASI_Mm01_00029536 predicted 2568
8 SASI_Mm01_00029537 predicted 1008
9 SASI_Mm01_00029538 predicted 462
10 SASI_Mm01_00029539 predicted 1526
11 SASI_Mm01_00029535 predicted 1822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018695
VALIDATED
ERBB2IP MISSION shRNA Bacterial Glycerol Stock
erbb2 interacting protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-1185s21c1
Sequence:CCGGGACTCTATAGGAGGGTTAATACTCGAGTATTAACCCTCCTATAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-2987s21c1
Sequence:CCGGGCAGCCAAGTACAACCGTTAACTCGAGTTAACGGTTGTACTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-3693s21c1
Sequence:CCGGGCACGAACATACAGCATAGATCTCGAGATCTATGCTGTATGTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018695.2-4586s21c1
Sequence:CCGGGAACCACTGTACAGAATATAACTCGAGTTATATTCTGTACAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-566s21c1
Sequence:CCGGATCCATTGCAAACCTTATTAACTCGAGTTAATAAGGTTTGCAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-2260s21c1
Sequence:CCGGGCAATCAGAATAACAGCAATTCTCGAGAATTGCTGTTATTCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-3002s1c1
Sequence:CCGGGCAGCCAAGTACAACCGTTAACTCGAGTTAACGGTTGTACTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-3534s1c1
Sequence:CCGGCGAAGTACAATCCAGCGACAACTCGAGTTGTCGCTGGATTGTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-2275s1c1
Sequence:CCGGGCAATCAGAATAACAGCAATTCTCGAGAATTGCTGTTATTCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-1692s1c1
Sequence:CCGGCGGGCTCAAGTTGCATTTGAACTCGAGTTCAAATGCAACTTGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-3708s1c1
Sequence:CCGGGCACGAACATACAGCATAGATCTCGAGATCTATGCTGTATGTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018695
VALIDATED
ERBB2IP MISSION shRNA shRNA Plasmid DNA
erbb2 interacting protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-1185s21c1
Sequence:CCGGGACTCTATAGGAGGGTTAATACTCGAGTATTAACCCTCCTATAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-2987s21c1
Sequence:CCGGGCAGCCAAGTACAACCGTTAACTCGAGTTAACGGTTGTACTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-3693s21c1
Sequence:CCGGGCACGAACATACAGCATAGATCTCGAGATCTATGCTGTATGTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018695.2-4586s21c1
Sequence:CCGGGAACCACTGTACAGAATATAACTCGAGTTATATTCTGTACAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-566s21c1
Sequence:CCGGATCCATTGCAAACCTTATTAACTCGAGTTAATAAGGTTTGCAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-2260s21c1
Sequence:CCGGGCAATCAGAATAACAGCAATTCTCGAGAATTGCTGTTATTCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-3002s1c1
Sequence:CCGGGCAGCCAAGTACAACCGTTAACTCGAGTTAACGGTTGTACTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-3534s1c1
Sequence:CCGGCGAAGTACAATCCAGCGACAACTCGAGTTGTCGCTGGATTGTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-2275s1c1
Sequence:CCGGGCAATCAGAATAACAGCAATTCTCGAGAATTGCTGTTATTCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-1692s1c1
Sequence:CCGGCGGGCTCAAGTTGCATTTGAACTCGAGTTCAAATGCAACTTGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-3708s1c1
Sequence:CCGGGCACGAACATACAGCATAGATCTCGAGATCTATGCTGTATGTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018695
VALIDATED
ERBB2IP MISSION shRNA Lentiviral Transduction Particles
erbb2 interacting protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-1185s21c1
Sequence:CCGGGACTCTATAGGAGGGTTAATACTCGAGTATTAACCCTCCTATAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-2987s21c1
Sequence:CCGGGCAGCCAAGTACAACCGTTAACTCGAGTTAACGGTTGTACTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-3693s21c1
Sequence:CCGGGCACGAACATACAGCATAGATCTCGAGATCTATGCTGTATGTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018695.2-4586s21c1
Sequence:CCGGGAACCACTGTACAGAATATAACTCGAGTTATATTCTGTACAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-566s21c1
Sequence:CCGGATCCATTGCAAACCTTATTAACTCGAGTTAATAAGGTTTGCAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018695.2-2260s21c1
Sequence:CCGGGCAATCAGAATAACAGCAATTCTCGAGAATTGCTGTTATTCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-3002s1c1
Sequence:CCGGGCAGCCAAGTACAACCGTTAACTCGAGTTAACGGTTGTACTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-3534s1c1
Sequence:CCGGCGAAGTACAATCCAGCGACAACTCGAGTTGTCGCTGGATTGTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-2275s1c1
Sequence:CCGGGCAATCAGAATAACAGCAATTCTCGAGAATTGCTGTTATTCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-1692s1c1
Sequence:CCGGCGGGCTCAAGTTGCATTTGAACTCGAGTTCAAATGCAACTTGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018695.1-3708s1c1
Sequence:CCGGGCACGAACATACAGCATAGATCTCGAGATCTATGCTGTATGTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005868
VALIDATED
ERBB2IP MISSION shRNA Bacterial Glycerol Stock
erbb2 interacting protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001005868.1-3731s21c1
Sequence:CCGGGAGTGCCCGTCCCTCTATTAACTCGAGTTAATAGAGGGACGGGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001005868.1-394s21c1
Sequence:CCGGCAGTCACTACTCTAGATTATTCTCGAGAATAATCTAGAGTAGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001005868.1-4869s21c1
Sequence:CCGGGTTGGATTCAAATCAGATAAACTCGAGTTTATCTGATTTGAATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001005868.1-1130s21c1
Sequence:CCGGGCCGGAAACTATTGGTTCATTCTCGAGAATGAACCAATAGTTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001005868.1-1130s1c1
Sequence:CCGGGCCGGAAACTATTGGTTCATTCTCGAGAATGAACCAATAGTTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005868.1-1200s1c1
Sequence:CCGGCCAGACTCAATAGGAGGGTTACTCGAGTAACCCTCCTATTGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001005868.1-5533s1c1
Sequence:CCGGCGCTCCATCATAATCTAATTTCTCGAGAAATTAGATTATGATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001005868.1-2235s1c1
Sequence:CCGGGCAGACTCTTTATCCGATGAACTCGAGTTCATCGGATAAAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005868.1-4199s1c1
Sequence:CCGGGCCTTTGAGTAATGGACAAATCTCGAGATTTGTCCATTACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005868
VALIDATED
ERBB2IP MISSION shRNA shRNA Plasmid DNA
erbb2 interacting protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001005868.1-3731s21c1
Sequence:CCGGGAGTGCCCGTCCCTCTATTAACTCGAGTTAATAGAGGGACGGGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001005868.1-394s21c1
Sequence:CCGGCAGTCACTACTCTAGATTATTCTCGAGAATAATCTAGAGTAGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001005868.1-4869s21c1
Sequence:CCGGGTTGGATTCAAATCAGATAAACTCGAGTTTATCTGATTTGAATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001005868.1-1130s21c1
Sequence:CCGGGCCGGAAACTATTGGTTCATTCTCGAGAATGAACCAATAGTTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001005868.1-1130s1c1
Sequence:CCGGGCCGGAAACTATTGGTTCATTCTCGAGAATGAACCAATAGTTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005868.1-1200s1c1
Sequence:CCGGCCAGACTCAATAGGAGGGTTACTCGAGTAACCCTCCTATTGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001005868.1-5533s1c1
Sequence:CCGGCGCTCCATCATAATCTAATTTCTCGAGAAATTAGATTATGATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001005868.1-2235s1c1
Sequence:CCGGGCAGACTCTTTATCCGATGAACTCGAGTTCATCGGATAAAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005868.1-4199s1c1
Sequence:CCGGGCCTTTGAGTAATGGACAAATCTCGAGATTTGTCCATTACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005868
VALIDATED
ERBB2IP MISSION shRNA Lentiviral Transduction Particles
erbb2 interacting protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001005868.1-3731s21c1
Sequence:CCGGGAGTGCCCGTCCCTCTATTAACTCGAGTTAATAGAGGGACGGGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001005868.1-394s21c1
Sequence:CCGGCAGTCACTACTCTAGATTATTCTCGAGAATAATCTAGAGTAGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001005868.1-4869s21c1
Sequence:CCGGGTTGGATTCAAATCAGATAAACTCGAGTTTATCTGATTTGAATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001005868.1-1130s21c1
Sequence:CCGGGCCGGAAACTATTGGTTCATTCTCGAGAATGAACCAATAGTTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001005868.1-1130s1c1
Sequence:CCGGGCCGGAAACTATTGGTTCATTCTCGAGAATGAACCAATAGTTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005868.1-1200s1c1
Sequence:CCGGCCAGACTCAATAGGAGGGTTACTCGAGTAACCCTCCTATTGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001005868.1-5533s1c1
Sequence:CCGGCGCTCCATCATAATCTAATTTCTCGAGAAATTAGATTATGATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001005868.1-2235s1c1
Sequence:CCGGGCAGACTCTTTATCCGATGAACTCGAGTTCATCGGATAAAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005868.1-4199s1c1
Sequence:CCGGGCCTTTGAGTAATGGACAAATCTCGAGATTTGTCCATTACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks