EMAIL THIS PAGE TO A FRIEND

ERBB3

v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3

189 Gene Product Result for
Synonyms: ErbB-3 HER3 LCCS2 MDA-BF-1 c-erbB-3 c-erbB3 erbB3-S p180-ErbB3 p45-sErbB3 p85-sErbB3
UniProtKB ID: P21860, A8K6L6, B4DIK7, B4DV32, E9PDT8, Q9BUD7
Gene ID:
Human(2065) Summary: This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
Mouse(13867) v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
Rat(29496) v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3
sheep(101103889) v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
Domestic Rabbit(100008807) v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
naked mole-rat(101721671) v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
domestic guinea pig(100712946) v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
chicken(693245) v-erb-b2 erythroblastic leukemia viral oncogene homolog 3
cow(785655) v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
Horse(100059216) v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
domestic cat(101085388) v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
dog(481105) v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500081 Anti-C-ERBB3 antibody, Rabbit monoclonal clone SP71, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB4300579 Anti-ERBB3 (Ab-1289) antibody produced in rabbit affinity isolated antibody human
immunofluorescence pricing
SAB4300580 Anti-ERBB3 (Ab-1328) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
HPA045396 Anti-ERBB3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2500361 Anti-ERBB3/HER3 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human, rat, mouse
ELISA, western blot pricing
SAB4500790 Anti-HER3, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500791 Anti-HER3, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500792 Anti-HER3, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4500793 Anti-HER3, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4300265 Anti-phospho-ERBB3 (pTyr1328) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504741 Anti-phospho-HER3 (pTyr1197) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4504193 Anti-phospho-HER3 (pTyr1222) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504194 Anti-phospho-HER3 (pTyr1289) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence pricing
WH0002065M1 Monoclonal Anti-ERBB3 antibody produced in mouse clone 2E9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403788 Monoclonal Anti-ERBB3, (C-terminal) antibody produced in mouse clone 3F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001982 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_125954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_010153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005915 Rosetta Predictions human pricing
NM_001982 Rosetta Predictions human pricing
NM_017218 Rosetta Predictions rat pricing
NM_010153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193248 predicted 311
2 SASI_Hs01_00193249 predicted 279
3 SASI_Hs01_00193251 predicted 328
4 SASI_Hs01_00193252 predicted 308
5 SASI_Hs01_00193253 predicted 330
6 SASI_Hs02_00305052 predicted 330
7 SASI_Hs02_00305053 predicted 298
8 SASI_Hs01_00193255 predicted 198
9 SASI_Hs01_00193256 predicted 272
10 SASI_Hs01_00193257 predicted 240
11 SASI_Hs01_00193250 predicted 286
12 SASI_Hs01_00193254 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196190 predicted 302
2 SASI_Hs01_00196191 predicted 287
3 SASI_Hs01_00196193 predicted 337
4 SASI_Hs01_00196194 predicted 306
5 SASI_Hs01_00196195 predicted 333
6 SASI_Hs02_00332963 predicted 326
7 SASI_Hs02_00332964 predicted 295
8 SASI_Hs01_00196197 predicted 199
9 SASI_Hs01_00196198 predicted 270
10 SASI_Hs01_00196199 predicted 249
11 SASI_Hs01_00196192 predicted 280
12 SASI_Hs01_00196196 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086939 predicted 1053
2 SASI_Rn01_00086940 predicted 2967
3 SASI_Rn01_00086941 predicted 2361
4 SASI_Rn02_00261583 predicted 468
5 SASI_Rn01_00086943 predicted 2873
6 SASI_Rn01_00086944 predicted 2824
7 SASI_Rn01_00086946 predicted 2464
8 SASI_Rn01_00086947 predicted 1506
9 SASI_Rn01_00086948 predicted 2044
10 SASI_Rn02_00261584 predicted 2811
11 SASI_Rn01_00086942 predicted 2597
12 SASI_Rn01_00086945 predicted 2991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031804 predicted 2528
2 SASI_Mm01_00031805 predicted 328
3 SASI_Mm01_00031806 predicted 1954
4 SASI_Mm01_00031807 predicted 1300
5 SASI_Mm01_00031809 predicted 592
6 SASI_Mm01_00031810 predicted 2512
7 SASI_Mm01_00031811 predicted 2678
8 SASI_Mm02_00317900 predicted 1767
9 SASI_Mm02_00317901 predicted 2983
10 SASI_Mm02_00317902 predicted 2872
11 SASI_Mm01_00031803 predicted 2848
12 SASI_Mm01_00031808 predicted 2204
13 SASI_Mm01_00031812 predicted 1035
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001982
VALIDATED
ERBB3 MISSION shRNA Bacterial Glycerol Stock
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.1-1904s1c1
Sequence:CCGGGCTCTGATACTTGTGCTCAATCTCGAGATTGAGCACAAGTATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001982.1-2653s1c1
Sequence:CCGGGCCAAGGGAATGTACTACCTTCTCGAGAAGGTAGTACATTCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001982.1-2068s1c1
Sequence:CCGGCCAGAGCTTCAAGACTGTTTACTCGAGTAAACAGTCTTGAAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.1-3293s1c1
Sequence:CCGGGCCTACCAGTTGGAACACTTACTCGAGTAAGTGTTCCAACTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-3982s1c1
Sequence:CCGGTATATGAATCGGCAACGAGATCTCGAGATCTCGTTGCCGATTCATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-475s1c1
Sequence:CCGGAATTCTCTACTCTACCATTGCTCGAGCAATGGTAGAGTAGAGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001982.x-4570s1c1
Sequence:CCGGGCTCTTATGTGTGCCTTTGTTCTCGAGAACAAAGGCACACATAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-1117s1c1
Sequence:CCGGCCTGACAAGATGGAAGTAGATCTCGAGATCTACTTCCATCTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-4705s1c1
Sequence:CCGGAGGTTAGGAGTAGATATTGACTCGAGTCAATATCTACTCCTAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001982.x-1639s1c1
Sequence:CCGGCGACTAGACATCAAGCATAATCTCGAGATTATGCTTGATGTCTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-4160s1c1
Sequence:CCGGCTGCCTTTGATAACCCTGATTCTCGAGAATCAGGGTTATCAAAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001982.2-3110s1c1
Sequence:CCGGCCACGGTATCTGGTCATAAAGCTCGAGCTTTATGACCAGATACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001982.2-5214s1c1
Sequence:CCGGCCTGTGCATGTGCTCTTATTGCTCGAGCAATAAGAGCACATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001982.2-544s1c1
Sequence:CCGGCTTCGTCATGTTGAACTATAACTCGAGTTATAGTTCAACATGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001982.2-4762s21c1
Sequence:CCGGTACTAAACTTCACCTACATTACTCGAGTAATGTAGGTGAAGTTTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001982.2-983s21c1
Sequence:GTACCGGGTCTACAACAAGCTAACTTTCCTCGAGGAAAGTTAGCTTGTTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001982.2-2829s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001982.2-2541s21c1
Sequence:GTACCGGTGCAGCTTGTCACTCAATATTCTCGAGAATATTGAGTGACAAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001982.2-1635s21c1
Sequence:GTACCGGGACTAGACATCAAGCATAATCCTCGAGGATTATGCTTGATGTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001982.2-545s21c1
Sequence:CCGGTTCGTCATGTTGAACTATAACCTCGAGGTTATAGTTCAACATGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001982
VALIDATED
ERBB3 MISSION shRNA shRNA Plasmid DNA
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.1-1904s1c1
Sequence:CCGGGCTCTGATACTTGTGCTCAATCTCGAGATTGAGCACAAGTATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001982.1-2653s1c1
Sequence:CCGGGCCAAGGGAATGTACTACCTTCTCGAGAAGGTAGTACATTCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001982.1-2068s1c1
Sequence:CCGGCCAGAGCTTCAAGACTGTTTACTCGAGTAAACAGTCTTGAAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.1-3293s1c1
Sequence:CCGGGCCTACCAGTTGGAACACTTACTCGAGTAAGTGTTCCAACTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-3982s1c1
Sequence:CCGGTATATGAATCGGCAACGAGATCTCGAGATCTCGTTGCCGATTCATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-475s1c1
Sequence:CCGGAATTCTCTACTCTACCATTGCTCGAGCAATGGTAGAGTAGAGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001982.x-4570s1c1
Sequence:CCGGGCTCTTATGTGTGCCTTTGTTCTCGAGAACAAAGGCACACATAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-1117s1c1
Sequence:CCGGCCTGACAAGATGGAAGTAGATCTCGAGATCTACTTCCATCTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-4705s1c1
Sequence:CCGGAGGTTAGGAGTAGATATTGACTCGAGTCAATATCTACTCCTAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001982.x-1639s1c1
Sequence:CCGGCGACTAGACATCAAGCATAATCTCGAGATTATGCTTGATGTCTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-4160s1c1
Sequence:CCGGCTGCCTTTGATAACCCTGATTCTCGAGAATCAGGGTTATCAAAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001982.2-3110s1c1
Sequence:CCGGCCACGGTATCTGGTCATAAAGCTCGAGCTTTATGACCAGATACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001982.2-5214s1c1
Sequence:CCGGCCTGTGCATGTGCTCTTATTGCTCGAGCAATAAGAGCACATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001982.2-544s1c1
Sequence:CCGGCTTCGTCATGTTGAACTATAACTCGAGTTATAGTTCAACATGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001982.2-4762s21c1
Sequence:CCGGTACTAAACTTCACCTACATTACTCGAGTAATGTAGGTGAAGTTTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001982.2-983s21c1
Sequence:GTACCGGGTCTACAACAAGCTAACTTTCCTCGAGGAAAGTTAGCTTGTTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001982.2-2829s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001982.2-2541s21c1
Sequence:GTACCGGTGCAGCTTGTCACTCAATATTCTCGAGAATATTGAGTGACAAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001982.2-1635s21c1
Sequence:GTACCGGGACTAGACATCAAGCATAATCCTCGAGGATTATGCTTGATGTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001982.2-545s21c1
Sequence:CCGGTTCGTCATGTTGAACTATAACCTCGAGGTTATAGTTCAACATGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001982
VALIDATED
ERBB3 MISSION shRNA Lentiviral Transduction Particles
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.1-1904s1c1
Sequence:CCGGGCTCTGATACTTGTGCTCAATCTCGAGATTGAGCACAAGTATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001982.1-2653s1c1
Sequence:CCGGGCCAAGGGAATGTACTACCTTCTCGAGAAGGTAGTACATTCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001982.1-2068s1c1
Sequence:CCGGCCAGAGCTTCAAGACTGTTTACTCGAGTAAACAGTCTTGAAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.1-3293s1c1
Sequence:CCGGGCCTACCAGTTGGAACACTTACTCGAGTAAGTGTTCCAACTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-3982s1c1
Sequence:CCGGTATATGAATCGGCAACGAGATCTCGAGATCTCGTTGCCGATTCATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-475s1c1
Sequence:CCGGAATTCTCTACTCTACCATTGCTCGAGCAATGGTAGAGTAGAGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001982.x-4570s1c1
Sequence:CCGGGCTCTTATGTGTGCCTTTGTTCTCGAGAACAAAGGCACACATAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-1117s1c1
Sequence:CCGGCCTGACAAGATGGAAGTAGATCTCGAGATCTACTTCCATCTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-4705s1c1
Sequence:CCGGAGGTTAGGAGTAGATATTGACTCGAGTCAATATCTACTCCTAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001982.x-1639s1c1
Sequence:CCGGCGACTAGACATCAAGCATAATCTCGAGATTATGCTTGATGTCTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001982.x-4160s1c1
Sequence:CCGGCTGCCTTTGATAACCCTGATTCTCGAGAATCAGGGTTATCAAAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001982.2-3110s1c1
Sequence:CCGGCCACGGTATCTGGTCATAAAGCTCGAGCTTTATGACCAGATACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001982.2-5214s1c1
Sequence:CCGGCCTGTGCATGTGCTCTTATTGCTCGAGCAATAAGAGCACATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001982.2-544s1c1
Sequence:CCGGCTTCGTCATGTTGAACTATAACTCGAGTTATAGTTCAACATGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001982.2-4762s21c1
Sequence:CCGGTACTAAACTTCACCTACATTACTCGAGTAATGTAGGTGAAGTTTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001982.2-983s21c1
Sequence:GTACCGGGTCTACAACAAGCTAACTTTCCTCGAGGAAAGTTAGCTTGTTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001982.2-2829s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001982.2-2541s21c1
Sequence:GTACCGGTGCAGCTTGTCACTCAATATTCTCGAGAATATTGAGTGACAAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001982.2-1635s21c1
Sequence:GTACCGGGACTAGACATCAAGCATAATCCTCGAGGATTATGCTTGATGTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001982.2-545s21c1
Sequence:CCGGTTCGTCATGTTGAACTATAACCTCGAGGTTATAGTTCAACATGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125954
VALIDATED
ERBB3 MISSION shRNA Bacterial Glycerol Stock
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125954.4-1504s1c1
Sequence:CCGGCGTGTCTACATAAGTGCCAATCTCGAGATTGGCACTTATGTAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125954.4-2044s1c1
Sequence:CCGGGCAGAGGTATTAATGAGCAAACTCGAGTTTGCTCATTAATACCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125954.4-2519s1c1
Sequence:CCGGGCTCTCTCCTTGATCATGTAACTCGAGTTACATGATCAAGGAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_125954.4-2981s1c1
Sequence:CCGGGTTGGATGATTGACGAGAATACTCGAGTATTCTCGTCAATCATCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125954.4-738s1c1
Sequence:CCGGCCAGATATTGACCAAGACCATCTCGAGATGGTCTTGGTCAATATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125954
VALIDATED
ERBB3 MISSION shRNA shRNA Plasmid DNA
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125954.4-1504s1c1
Sequence:CCGGCGTGTCTACATAAGTGCCAATCTCGAGATTGGCACTTATGTAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125954.4-2044s1c1
Sequence:CCGGGCAGAGGTATTAATGAGCAAACTCGAGTTTGCTCATTAATACCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125954.4-2519s1c1
Sequence:CCGGGCTCTCTCCTTGATCATGTAACTCGAGTTACATGATCAAGGAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_125954.4-2981s1c1
Sequence:CCGGGTTGGATGATTGACGAGAATACTCGAGTATTCTCGTCAATCATCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125954.4-738s1c1
Sequence:CCGGCCAGATATTGACCAAGACCATCTCGAGATGGTCTTGGTCAATATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125954
VALIDATED
ERBB3 MISSION shRNA Lentiviral Transduction Particles
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125954.4-1504s1c1
Sequence:CCGGCGTGTCTACATAAGTGCCAATCTCGAGATTGGCACTTATGTAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125954.4-2044s1c1
Sequence:CCGGGCAGAGGTATTAATGAGCAAACTCGAGTTTGCTCATTAATACCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125954.4-2519s1c1
Sequence:CCGGGCTCTCTCCTTGATCATGTAACTCGAGTTACATGATCAAGGAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_125954.4-2981s1c1
Sequence:CCGGGTTGGATGATTGACGAGAATACTCGAGTATTCTCGTCAATCATCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125954.4-738s1c1
Sequence:CCGGCCAGATATTGACCAAGACCATCTCGAGATGGTCTTGGTCAATATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010153
ERBB3 MISSION shRNA Bacterial Glycerol Stock
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-1716s21c1
Sequence:CCGGTTGTGCTCGATGCGCCCATTTCTCGAGAAATGGGCGCATCGAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-2630s21c1
Sequence:CCGGCCCTTGAGAGTATCCACTTTGCTCGAGCAAAGTGGATACTCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-463s21c1
Sequence:CCGGCTTTGCCACATGGATACAATTCTCGAGAATTGTATCCATGTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-1174s21c1
Sequence:CCGGGAGATTACAGGCTACCTAAACCTCGAGGTTTAGGTAGCCTGTAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-1023s21c1
Sequence:CCGGGACCGTGGACTCTAGCAATATCTCGAGATATTGCTAGAGTCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-2602s21c1
Sequence:CCGGGAGGCCAAGACTCCAATTAAACTCGAGTTTAATTGGAGTCTTGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010153
ERBB3 MISSION shRNA shRNA Plasmid DNA
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-1716s21c1
Sequence:CCGGTTGTGCTCGATGCGCCCATTTCTCGAGAAATGGGCGCATCGAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-2630s21c1
Sequence:CCGGCCCTTGAGAGTATCCACTTTGCTCGAGCAAAGTGGATACTCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-463s21c1
Sequence:CCGGCTTTGCCACATGGATACAATTCTCGAGAATTGTATCCATGTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-1174s21c1
Sequence:CCGGGAGATTACAGGCTACCTAAACCTCGAGGTTTAGGTAGCCTGTAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-1023s21c1
Sequence:CCGGGACCGTGGACTCTAGCAATATCTCGAGATATTGCTAGAGTCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-2602s21c1
Sequence:CCGGGAGGCCAAGACTCCAATTAAACTCGAGTTTAATTGGAGTCTTGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010153
ERBB3 MISSION shRNA Lentiviral Transduction Particles
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-1716s21c1
Sequence:CCGGTTGTGCTCGATGCGCCCATTTCTCGAGAAATGGGCGCATCGAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-2630s21c1
Sequence:CCGGCCCTTGAGAGTATCCACTTTGCTCGAGCAAAGTGGATACTCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-463s21c1
Sequence:CCGGCTTTGCCACATGGATACAATTCTCGAGAATTGTATCCATGTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-1174s21c1
Sequence:CCGGGAGATTACAGGCTACCTAAACCTCGAGGTTTAGGTAGCCTGTAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-1023s21c1
Sequence:CCGGGACCGTGGACTCTAGCAATATCTCGAGATATTGCTAGAGTCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010153.1-2602s21c1
Sequence:CCGGGAGGCCAAGACTCCAATTAAACTCGAGTTTAATTGGAGTCTTGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks