EMAIL THIS PAGE TO A FRIEND

ERBB4

v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4

342 Gene Product Result for
Synonyms: HER4 p180erbB4
UniProtKB ID: Q15303, B7ZLD7, B7ZLE2, B7ZLE3, Q2M1W1, Q59EW4
Gene ID:
Human(2066) Summary: This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Mouse(13869) v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)
Rat(59323) v-erb-b2 avian erythroblastic leukemia viral oncogene 4
chicken(395671) v-erb-a erythroblastic leukemia viral oncogene homolog 4
dog(488508) v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)
Horse(100050182) v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)
cow(522419) v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4
domestic cat(101100073) v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)
domestic guinea pig(100724678) v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)
naked mole-rat(101725806) v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)
sheep(101103044) v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)
Domestic Rabbit(100009328) v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012016 Anti-ERBB4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1305670 ANTI-HER4 (C-TERM Y1162) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
SAB4500794 Anti-HER4, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry pricing
SAB1302594 ANTI-MOUSE ERBB4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4504195 Anti-phospho-HER4 (pTyr1284) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301542 Anti-phospho-HER4 (pTyr1284) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB1306712 ANTI-PHOSPHO-HER4(Y1162) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306304 ANTI-PHOSPHO-HER4(Y1188) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
E5900 Monoclonal Anti-c-erbB-4 antibody produced in mouse ~2 mg/mL, clone HER4-36, purified immunoglobulin, buffered aqueous solution human
immunoprecipitation, microarray pricing
PLA0129 Rabbit anti-ErbB4 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. toad, guinea pig, human, dog, pig, chicken, bovine, horse, rabbit, primate, toad
immunoprecipitation, proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A9251 Adenosine ≥99% human, rat pricing
A4036 Adenosine suitable for cell culture, BioReagent human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005235 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010154 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010154 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010154 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_136682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_136682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_136682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042599 Rosetta Predictions human pricing
NM_005235 Rosetta Predictions human pricing
NM_021687 Rosetta Predictions rat pricing
NM_010154 Rosetta Predictions mouse pricing
XM_001002143 Rosetta Predictions mouse pricing
XM_136682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310748 predicted 945
2 SASI_Hs02_00310749 predicted 521
3 SASI_Hs02_00310750 predicted 2049
4 SASI_Hs02_00310751 predicted 984
5 SASI_Hs02_00310752 predicted 1196
6 SASI_Hs02_00310753 predicted 433
7 SASI_Hs02_00310754 predicted 1967
8 SASI_Hs02_00310755 predicted 630
9 SASI_Hs02_00310756 predicted 2356
10 SASI_Hs02_00310757 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339239 predicted 949
2 SASI_Hs01_00025144 predicted 516
3 SASI_Hs01_00025145 predicted 2044
4 SASI_Hs02_00339240 predicted 985
5 SASI_Hs01_00025146 predicted 1195
6 SASI_Hs01_00025147 predicted 437
7 SASI_Hs01_00025148 predicted 1968
8 SASI_Hs01_00025149 predicted 623
9 SASI_Hs02_00339241 predicted 2357
10 SASI_Hs02_00339242 predicted 1316
11 SASI_Hs01_00025150 predicted 883
12 SASI_Hs01_00025151 predicted 2876
13 SASI_Hs01_00025152 predicted 2006
14 SASI_Hs01_00025153 predicted 2741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262712 predicted 2398
2 SASI_Rn01_00112132 predicted 2804
3 SASI_Rn02_00262713 predicted 876
4 SASI_Rn01_00112133 predicted 514
5 SASI_Rn02_00262714 predicted 996
6 SASI_Rn01_00112134 predicted 1121
7 SASI_Rn01_00112135 predicted 2211
8 SASI_Rn01_00112136 predicted 1904
9 SASI_Rn01_00112137 predicted 1466
10 SASI_Rn01_00112139 predicted 418
11 SASI_Rn01_00112138 predicted 2106
12 SASI_Rn01_00112140 predicted 1482
13 SASI_Rn01_00112141 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317903 predicted 3635
2 SASI_Mm02_00317904 predicted 786
3 SASI_Mm02_00317905 predicted 3425
4 SASI_Mm02_00317906 predicted 1737
5 SASI_Mm02_00317907 predicted 2602
6 SASI_Mm02_00317908 predicted 1745
7 SASI_Mm02_00317909 predicted 2168
8 SASI_Mm02_00317910 predicted 762
9 SASI_Mm02_00317911 predicted 957
10 SASI_Mm02_00317912 predicted 3416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267620 predicted 3637
2 SASI_Mm01_00267621 predicted 794
3 SASI_Mm01_00267622 predicted 3432
4 SASI_Mm01_00267623 predicted 1237
5 SASI_Mm01_00267624 predicted 1739
6 SASI_Mm01_00267625 predicted 1755
7 SASI_Mm01_00267626 predicted 2173
8 SASI_Mm01_00267627 predicted 765
9 SASI_Mm01_00267628 predicted 958
10 SASI_Mm01_00267629 predicted 3417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_136682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249376 predicted 3679
2 SASI_Mm01_00249377 predicted 794
3 SASI_Mm01_00249378 predicted 1235
4 SASI_Mm01_00249379 predicted 1745
5 SASI_Mm01_00249380 predicted 2606
6 SASI_Mm01_00249381 predicted 1757
7 SASI_Mm01_00249382 predicted 2175
8 SASI_Mm01_00249383 predicted 765
9 SASI_Mm01_00249384 predicted 962
10 SASI_Mm01_00249385 predicted 1704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005235
VALIDATED
ERBB4 MISSION shRNA Bacterial Glycerol Stock
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4
Human
23 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2215s21c1
Sequence:GTACCGGATCAAGCTCAACTTCGTATTTCTCGAGAAATACGAAGTTGAGCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-1459s21c1
Sequence:CCGGGCGCAGGAAACATCTATATTACTCGAGTAATATAGATGTTTCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-393s21c1
Sequence:CCGGCTGGAGAATTTACGCATTATTCTCGAGAATAATGCGTAAATTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-3642s21c1
Sequence:CCGGGCATTGGATAATCCCGAATATCTCGAGATATTCGGGATTATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005235.2-4150s21c1
Sequence:CCGGCAGAGATGCAATGATAGTTATCTCGAGATAACTATCATTGCATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2053s21c1
Sequence:CCGGTGATTGCAGCTGGAGTAATTGCTCGAGCAATTACTCCAGCTGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2609s21c1
Sequence:GTACCGGACGACTCGTTCATCGGGATTTCTCGAGAAATCCCGATGAACGAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2174s21c1
Sequence:GTACCGGAGAGTTGGTGGAACCATTAACCTCGAGGTTAATGGTTCCACCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2524s21c1
Sequence:GTACCGGACGAGCACAAGGATAACATTGCTCGAGCAATGTTATCCTTGTGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005235.1-5234s1c1
Sequence:CCGGGCCAGCACATTATCTTCATATCTCGAGATATGAAGATAATGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005235.1-3146s1c1
Sequence:CCGGGAGCAAGAATTGACTCGAATACTCGAGTATTCGAGTCAATTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005235.1-373s1c1
Sequence:CCGGCGATATGCCTTGGCAATATTTCTCGAGAAATATTGCCAAGGCATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005235.x-4915s1c1
Sequence:CCGGCAGTTCTCTGTGGTTCAGGAACTCGAGTTCCTGAACCACAGAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005235.x-5156s1c1
Sequence:CCGGGCTAAGATAAAGACTGTGGAACTCGAGTTCCACAGTCTTTATCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.x-2272s1c1
Sequence:CCGGCCTGTGGCTATTAAGATTCTTCTCGAGAAGAATCTTAATAGCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005235.x-1394s1c1
Sequence:CCGGGCGCAGGAAACATCTATATTACTCGAGTAATATAGATGTTTCCTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.x-1254s1c1
Sequence:CCGGGCCACCAAACATGACTGACTTCTCGAGAAGTCAGTCATGTTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.x-3505s1c1
Sequence:CCGGCCCAAACAAGAATACCTGAATCTCGAGATTCAGGTATTCTTGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.x-3800s1c1
Sequence:CCGGCAGACTACCTGCAGGAGTACACTCGAGTGTACTCCTGCAGGTAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005235.1-4915s1c1
Sequence:CCGGAGTTCTCTGTGGTTCAGGAACCTCGAGGTTCCTGAACCACAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.1-1189s1c1
Sequence:CCGGCCAGAGAAACTGAACGTCTTTCTCGAGAAAGACGTTCAGTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.1-2569s1c1
Sequence:CCGGGCCCGTAATGTCTTAGTGAAACTCGAGTTTCACTAAGACATTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.1-483s1c1
Sequence:CCGGCCAGAACAAATTCCTTTGTTACTCGAGTAACAAAGGAATTTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005235
VALIDATED
ERBB4 MISSION shRNA shRNA Plasmid DNA
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4
Human
23 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2215s21c1
Sequence:GTACCGGATCAAGCTCAACTTCGTATTTCTCGAGAAATACGAAGTTGAGCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-1459s21c1
Sequence:CCGGGCGCAGGAAACATCTATATTACTCGAGTAATATAGATGTTTCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-393s21c1
Sequence:CCGGCTGGAGAATTTACGCATTATTCTCGAGAATAATGCGTAAATTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-3642s21c1
Sequence:CCGGGCATTGGATAATCCCGAATATCTCGAGATATTCGGGATTATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005235.2-4150s21c1
Sequence:CCGGCAGAGATGCAATGATAGTTATCTCGAGATAACTATCATTGCATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2053s21c1
Sequence:CCGGTGATTGCAGCTGGAGTAATTGCTCGAGCAATTACTCCAGCTGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2609s21c1
Sequence:GTACCGGACGACTCGTTCATCGGGATTTCTCGAGAAATCCCGATGAACGAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2174s21c1
Sequence:GTACCGGAGAGTTGGTGGAACCATTAACCTCGAGGTTAATGGTTCCACCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2524s21c1
Sequence:GTACCGGACGAGCACAAGGATAACATTGCTCGAGCAATGTTATCCTTGTGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005235.1-5234s1c1
Sequence:CCGGGCCAGCACATTATCTTCATATCTCGAGATATGAAGATAATGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005235.1-3146s1c1
Sequence:CCGGGAGCAAGAATTGACTCGAATACTCGAGTATTCGAGTCAATTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005235.1-373s1c1
Sequence:CCGGCGATATGCCTTGGCAATATTTCTCGAGAAATATTGCCAAGGCATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005235.x-4915s1c1
Sequence:CCGGCAGTTCTCTGTGGTTCAGGAACTCGAGTTCCTGAACCACAGAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005235.x-5156s1c1
Sequence:CCGGGCTAAGATAAAGACTGTGGAACTCGAGTTCCACAGTCTTTATCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.x-2272s1c1
Sequence:CCGGCCTGTGGCTATTAAGATTCTTCTCGAGAAGAATCTTAATAGCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005235.x-1394s1c1
Sequence:CCGGGCGCAGGAAACATCTATATTACTCGAGTAATATAGATGTTTCCTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.x-1254s1c1
Sequence:CCGGGCCACCAAACATGACTGACTTCTCGAGAAGTCAGTCATGTTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.x-3505s1c1
Sequence:CCGGCCCAAACAAGAATACCTGAATCTCGAGATTCAGGTATTCTTGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.x-3800s1c1
Sequence:CCGGCAGACTACCTGCAGGAGTACACTCGAGTGTACTCCTGCAGGTAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005235.1-4915s1c1
Sequence:CCGGAGTTCTCTGTGGTTCAGGAACCTCGAGGTTCCTGAACCACAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.1-1189s1c1
Sequence:CCGGCCAGAGAAACTGAACGTCTTTCTCGAGAAAGACGTTCAGTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.1-2569s1c1
Sequence:CCGGGCCCGTAATGTCTTAGTGAAACTCGAGTTTCACTAAGACATTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.1-483s1c1
Sequence:CCGGCCAGAACAAATTCCTTTGTTACTCGAGTAACAAAGGAATTTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005235
VALIDATED
ERBB4 MISSION shRNA Lentiviral Transduction Particles
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4
Human
23 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2215s21c1
Sequence:GTACCGGATCAAGCTCAACTTCGTATTTCTCGAGAAATACGAAGTTGAGCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-1459s21c1
Sequence:CCGGGCGCAGGAAACATCTATATTACTCGAGTAATATAGATGTTTCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-393s21c1
Sequence:CCGGCTGGAGAATTTACGCATTATTCTCGAGAATAATGCGTAAATTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-3642s21c1
Sequence:CCGGGCATTGGATAATCCCGAATATCTCGAGATATTCGGGATTATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005235.2-4150s21c1
Sequence:CCGGCAGAGATGCAATGATAGTTATCTCGAGATAACTATCATTGCATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2053s21c1
Sequence:CCGGTGATTGCAGCTGGAGTAATTGCTCGAGCAATTACTCCAGCTGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2609s21c1
Sequence:GTACCGGACGACTCGTTCATCGGGATTTCTCGAGAAATCCCGATGAACGAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2174s21c1
Sequence:GTACCGGAGAGTTGGTGGAACCATTAACCTCGAGGTTAATGGTTCCACCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005235.2-2524s21c1
Sequence:GTACCGGACGAGCACAAGGATAACATTGCTCGAGCAATGTTATCCTTGTGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005235.1-5234s1c1
Sequence:CCGGGCCAGCACATTATCTTCATATCTCGAGATATGAAGATAATGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005235.1-3146s1c1
Sequence:CCGGGAGCAAGAATTGACTCGAATACTCGAGTATTCGAGTCAATTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005235.1-373s1c1
Sequence:CCGGCGATATGCCTTGGCAATATTTCTCGAGAAATATTGCCAAGGCATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005235.x-4915s1c1
Sequence:CCGGCAGTTCTCTGTGGTTCAGGAACTCGAGTTCCTGAACCACAGAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005235.x-5156s1c1
Sequence:CCGGGCTAAGATAAAGACTGTGGAACTCGAGTTCCACAGTCTTTATCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.x-2272s1c1
Sequence:CCGGCCTGTGGCTATTAAGATTCTTCTCGAGAAGAATCTTAATAGCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005235.x-1394s1c1
Sequence:CCGGGCGCAGGAAACATCTATATTACTCGAGTAATATAGATGTTTCCTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.x-1254s1c1
Sequence:CCGGGCCACCAAACATGACTGACTTCTCGAGAAGTCAGTCATGTTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.x-3505s1c1
Sequence:CCGGCCCAAACAAGAATACCTGAATCTCGAGATTCAGGTATTCTTGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.x-3800s1c1
Sequence:CCGGCAGACTACCTGCAGGAGTACACTCGAGTGTACTCCTGCAGGTAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005235.1-4915s1c1
Sequence:CCGGAGTTCTCTGTGGTTCAGGAACCTCGAGGTTCCTGAACCACAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.1-1189s1c1
Sequence:CCGGCCAGAGAAACTGAACGTCTTTCTCGAGAAAGACGTTCAGTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.1-2569s1c1
Sequence:CCGGGCCCGTAATGTCTTAGTGAAACTCGAGTTTCACTAAGACATTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005235.1-483s1c1
Sequence:CCGGCCAGAACAAATTCCTTTGTTACTCGAGTAACAAAGGAATTTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010154
ERBB4 MISSION shRNA Bacterial Glycerol Stock
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010154.1-1752s21c1
Sequence:CCGGGAGAATAGTGATCCGAGATAACTCGAGTTATCTCGGATCACTATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010154.1-438s21c1
Sequence:CCGGGTACCGAGCCTTGCGCAAATACTCGAGTATTTGCGCAAGGCTCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010154.1-1270s21c1
Sequence:CCGGTGTAAGCCTTGCACCGATATTCTCGAGAATATCGGTGCAAGGCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010154.1-3015s21c1
Sequence:CCGGGAGCTATGGCGTCACTATATGCTCGAGCATATAGTGACGCCATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010154
ERBB4 MISSION shRNA shRNA Plasmid DNA
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010154.1-1752s21c1
Sequence:CCGGGAGAATAGTGATCCGAGATAACTCGAGTTATCTCGGATCACTATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010154.1-438s21c1
Sequence:CCGGGTACCGAGCCTTGCGCAAATACTCGAGTATTTGCGCAAGGCTCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010154.1-1270s21c1
Sequence:CCGGTGTAAGCCTTGCACCGATATTCTCGAGAATATCGGTGCAAGGCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010154.1-3015s21c1
Sequence:CCGGGAGCTATGGCGTCACTATATGCTCGAGCATATAGTGACGCCATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010154
ERBB4 MISSION shRNA Lentiviral Transduction Particles
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010154.1-1752s21c1
Sequence:CCGGGAGAATAGTGATCCGAGATAACTCGAGTTATCTCGGATCACTATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010154.1-438s21c1
Sequence:CCGGGTACCGAGCCTTGCGCAAATACTCGAGTATTTGCGCAAGGCTCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010154.1-1270s21c1
Sequence:CCGGTGTAAGCCTTGCACCGATATTCTCGAGAATATCGGTGCAAGGCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010154.1-3015s21c1
Sequence:CCGGGAGCTATGGCGTCACTATATGCTCGAGCATATAGTGACGCCATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_136682
ERBB4 MISSION shRNA Bacterial Glycerol Stock
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000023404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136682.3-99s1c1
Sequence:CCGGCCAGAACAAATTCCTATGTTACTCGAGTAACATAGGAATTTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136682.3-529s1c1
Sequence:CCGGCCACATAACTTCGTGGTAGATCTCGAGATCTACCACGAAGTTATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136682.3-1651s1c1
Sequence:CCGGGCTTTGACATTTGCTGTCTATCTCGAGATAGACAGCAAATGTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_136682
ERBB4 MISSION shRNA shRNA Plasmid DNA
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000023404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136682.3-99s1c1
Sequence:CCGGCCAGAACAAATTCCTATGTTACTCGAGTAACATAGGAATTTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136682.3-529s1c1
Sequence:CCGGCCACATAACTTCGTGGTAGATCTCGAGATCTACCACGAAGTTATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136682.3-1651s1c1
Sequence:CCGGGCTTTGACATTTGCTGTCTATCTCGAGATAGACAGCAAATGTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_136682
ERBB4 MISSION shRNA Lentiviral Transduction Particles
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000023404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136682.3-99s1c1
Sequence:CCGGCCAGAACAAATTCCTATGTTACTCGAGTAACATAGGAATTTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136682.3-529s1c1
Sequence:CCGGCCACATAACTTCGTGGTAGATCTCGAGATCTACCACGAAGTTATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136682.3-1651s1c1
Sequence:CCGGGCTTTGACATTTGCTGTCTATCTCGAGATAGACAGCAAATGTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks