EMAIL THIS PAGE TO A FRIEND

ERC1

ELKS/RAB6-interacting/CAST family member 1

169 Gene Product Result for
Synonyms: Cast2 ELKS RAB6IP2
Gene ID:
Human(23085) Summary: The protein encoded by this gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. This gene has been found fused to the receptor-type tyrosine kinase gene RET by gene rearrangement due to the translocation t(10;12)(q11;p13). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(111173) ELKS/RAB6-interacting/CAST family member 1
Rat(266806) ELKS/RAB6-interacting/CAST family member 1
chicken(418153) ELKS/RAB6-interacting/CAST family member 1
dog(486753) ELKS/RAB6-interacting/CAST family member 1
Horse(100050184) ELKS/RAB6-interacting/CAST family member 1
cow(519271) ELKS/RAB6-interacting/CAST family member 1
domestic cat(101086319) ELKS/RAB6-interacting/CAST family member 1
sheep(101121000) ELKS/RAB6-interacting/CAST family member 1
Domestic Rabbit(100350081) ELKS/RAB6-interacting/CAST family member 1
naked mole-rat(101698544) ELKS/RAB6-interacting/CAST family member 1
domestic guinea pig(100719751) ELKS/RAB6-interacting/CAST family member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015064 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053204 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053204 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053204 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015064 Rosetta Predictions human pricing
NM_178037 Rosetta Predictions human pricing
NM_178038 Rosetta Predictions human pricing
NM_178039 Rosetta Predictions human pricing
NM_178040 Rosetta Predictions human pricing
NM_170788 Rosetta Predictions rat pricing
NM_053204 Rosetta Predictions mouse pricing
NM_178085 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086890 predicted 3688
2 SASI_Hs01_00086891 predicted 812
3 SASI_Hs01_00086893 predicted 2401
4 SASI_Hs02_00346920 predicted 2248
5 SASI_Hs01_00086894 predicted 620
6 SASI_Hs01_00086895 predicted 2327
7 SASI_Hs01_00086896 predicted 2346
8 SASI_Hs01_00086897 predicted 3491
9 SASI_Hs01_00086898 predicted 3522
10 SASI_Hs01_00086899 predicted 2108
11 SASI_Hs01_00086892 predicted 3756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137241 predicted 3816
2 SASI_Hs01_00137242 predicted 813
3 SASI_Hs01_00137244 predicted 2403
4 SASI_Hs02_00369518 predicted 2249
5 SASI_Hs01_00137245 predicted 618
6 SASI_Hs01_00137246 predicted 2328
7 SASI_Hs01_00137247 predicted 2352
8 SASI_Hs01_00137248 predicted 3625
9 SASI_Hs01_00137249 predicted 3652
10 SASI_Hs01_00137250 predicted 2108
11 SASI_Hs01_00137243 predicted 3888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192438 predicted 2843
2 SASI_Hs01_00192439 predicted 642
3 SASI_Hs01_00192441 predicted 1418
4 SASI_Hs02_00369519 predicted 1273
5 SASI_Hs01_00192442 predicted 454
6 SASI_Hs01_00192443 predicted 1346
7 SASI_Hs01_00192444 predicted 1369
8 SASI_Hs01_00192445 predicted 2642
9 SASI_Hs01_00192446 predicted 2672
10 SASI_Hs01_00192447 predicted 1128
11 SASI_Hs01_00192440 predicted 2908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215487 predicted 599
2 SASI_Hs01_00215488 predicted 3577
3 SASI_Hs01_00215489 predicted 651
4 SASI_Hs01_00215491 predicted 2236
5 SASI_Hs02_00369520 predicted 2080
6 SASI_Hs01_00215492 predicted 454
7 SASI_Hs01_00215493 predicted 2164
8 SASI_Hs01_00215494 predicted 2189
9 SASI_Hs01_00215495 predicted 3384
10 SASI_Hs01_00215496 predicted 3415
11 SASI_Hs01_00215490 predicted 3594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129166 predicted 604
2 SASI_Hs01_00129167 predicted 3663
3 SASI_Hs01_00129168 predicted 643
4 SASI_Hs01_00129170 predicted 2316
5 SASI_Hs02_00369521 predicted 2169
6 SASI_Hs01_00129171 predicted 455
7 SASI_Hs01_00129172 predicted 2247
8 SASI_Hs01_00129173 predicted 2267
9 SASI_Hs01_00129174 predicted 3464
10 SASI_Hs01_00129175 predicted 3498
11 SASI_Hs01_00129169 predicted 3681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050226 predicted 669
2 SASI_Rn01_00050227 predicted 3094
3 SASI_Rn02_00269067 predicted 449
4 SASI_Rn01_00050228 predicted 753
5 SASI_Rn01_00050229 predicted 772
6 SASI_Rn01_00050230 predicted 3013
7 SASI_Rn01_00050231 predicted 743
8 SASI_Rn01_00050232 predicted 1161
9 SASI_Rn01_00050233 predicted 3081
10 SASI_Rn01_00050234 predicted 2352
11 SASI_Rn01_00050235 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068664 predicted 1459
2 SASI_Mm01_00068665 predicted 1279
3 SASI_Mm01_00068666 predicted 1574
4 SASI_Mm01_00068668 predicted 1656
5 SASI_Mm02_00337781 predicted 1468
6 SASI_Mm01_00068669 predicted 1515
7 SASI_Mm01_00068670 predicted 1429
8 SASI_Mm01_00068671 predicted 1644
9 SASI_Mm01_00068673 predicted 1271
10 SASI_Mm02_00337782 predicted 1278
11 SASI_Mm01_00068667 predicted 1439
12 SASI_Mm01_00068672 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072424 predicted 737
2 SASI_Mm01_00072425 predicted 556
3 SASI_Mm01_00072426 predicted 853
4 SASI_Mm01_00072428 predicted 927
5 SASI_Mm02_00348558 predicted 740
6 SASI_Mm01_00072429 predicted 789
7 SASI_Mm01_00072430 predicted 702
8 SASI_Mm01_00072431 predicted 924
9 SASI_Mm01_00072433 predicted 542
10 SASI_Mm02_00348559 predicted 553
11 SASI_Mm01_00072427 predicted 684
12 SASI_Mm01_00072432 predicted 671
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015064
VALIDATED
ERC1 MISSION shRNA Bacterial Glycerol Stock
ELKS/RAB6-interacting/CAST family member 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015064.2-2513s1c1
Sequence:CCGGCCAGAGATGAGTGACCGAATACTCGAGTATTCGGTCACTCATCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015064.2-1235s1c1
Sequence:CCGGCAGGCCAAAGAGCTGTTTCTTCTCGAGAAGAAACAGCTCTTTGGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015064.2-1308s1c1
Sequence:CCGGCCCTAAATGCTCGGGATGAATCTCGAGATTCATCCCGAGCATTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015064.2-616s1c1
Sequence:CCGGCCCTATGTATCTAAGTGACCACTCGAGTGGTCACTTAGATACATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015064.2-2588s1c1
Sequence:CCGGGCAGAAGTTGATCGACTCTTACTCGAGTAAGAGTCGATCAACTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015064.2-2109s1c1
Sequence:CCGGGCTTGAAAGAACGGGTCAAATCTCGAGATTTGACCCGTTCTTTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015064.2-2200s1c1
Sequence:CCGGGCGGACAATTGAACGCTTAAACTCGAGTTTAAGCGTTCAATTGTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015064.2-761s1c1
Sequence:CCGGGCTAGTGACACCATAGCATTTCTCGAGAAATGCTATGGTGTCACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015064.2-2858s1c1
Sequence:CCGGCAGGAACTAGAATCCATGAAACTCGAGTTTCATGGATTCTAGTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015064.2-6577s1c1
Sequence:CCGGGCAAGGACTTTGATACCATTTCTCGAGAAATGGTATCAAAGTCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015064.2-1782s1c1
Sequence:CCGGCAAAGCTAGAAACACTCACAACTCGAGTTGTGAGTGTTTCTAGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015064
VALIDATED
ERC1 MISSION shRNA shRNA Plasmid DNA
ELKS/RAB6-interacting/CAST family member 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015064.2-2513s1c1
Sequence:CCGGCCAGAGATGAGTGACCGAATACTCGAGTATTCGGTCACTCATCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015064.2-1235s1c1
Sequence:CCGGCAGGCCAAAGAGCTGTTTCTTCTCGAGAAGAAACAGCTCTTTGGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015064.2-1308s1c1
Sequence:CCGGCCCTAAATGCTCGGGATGAATCTCGAGATTCATCCCGAGCATTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015064.2-616s1c1
Sequence:CCGGCCCTATGTATCTAAGTGACCACTCGAGTGGTCACTTAGATACATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015064.2-2588s1c1
Sequence:CCGGGCAGAAGTTGATCGACTCTTACTCGAGTAAGAGTCGATCAACTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015064.2-2109s1c1
Sequence:CCGGGCTTGAAAGAACGGGTCAAATCTCGAGATTTGACCCGTTCTTTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015064.2-2200s1c1
Sequence:CCGGGCGGACAATTGAACGCTTAAACTCGAGTTTAAGCGTTCAATTGTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015064.2-761s1c1
Sequence:CCGGGCTAGTGACACCATAGCATTTCTCGAGAAATGCTATGGTGTCACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015064.2-2858s1c1
Sequence:CCGGCAGGAACTAGAATCCATGAAACTCGAGTTTCATGGATTCTAGTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015064.2-6577s1c1
Sequence:CCGGGCAAGGACTTTGATACCATTTCTCGAGAAATGGTATCAAAGTCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015064.2-1782s1c1
Sequence:CCGGCAAAGCTAGAAACACTCACAACTCGAGTTGTGAGTGTTTCTAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015064
VALIDATED
ERC1 MISSION shRNA Lentiviral Transduction Particles
ELKS/RAB6-interacting/CAST family member 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015064.2-2513s1c1
Sequence:CCGGCCAGAGATGAGTGACCGAATACTCGAGTATTCGGTCACTCATCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015064.2-1235s1c1
Sequence:CCGGCAGGCCAAAGAGCTGTTTCTTCTCGAGAAGAAACAGCTCTTTGGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015064.2-1308s1c1
Sequence:CCGGCCCTAAATGCTCGGGATGAATCTCGAGATTCATCCCGAGCATTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015064.2-616s1c1
Sequence:CCGGCCCTATGTATCTAAGTGACCACTCGAGTGGTCACTTAGATACATAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015064.2-2588s1c1
Sequence:CCGGGCAGAAGTTGATCGACTCTTACTCGAGTAAGAGTCGATCAACTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015064.2-2109s1c1
Sequence:CCGGGCTTGAAAGAACGGGTCAAATCTCGAGATTTGACCCGTTCTTTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015064.2-2200s1c1
Sequence:CCGGGCGGACAATTGAACGCTTAAACTCGAGTTTAAGCGTTCAATTGTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015064.2-761s1c1
Sequence:CCGGGCTAGTGACACCATAGCATTTCTCGAGAAATGCTATGGTGTCACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015064.2-2858s1c1
Sequence:CCGGCAGGAACTAGAATCCATGAAACTCGAGTTTCATGGATTCTAGTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015064.2-6577s1c1
Sequence:CCGGGCAAGGACTTTGATACCATTTCTCGAGAAATGGTATCAAAGTCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015064.2-1782s1c1
Sequence:CCGGCAAAGCTAGAAACACTCACAACTCGAGTTGTGAGTGTTTCTAGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053204
VALIDATED
ERC1 MISSION shRNA Bacterial Glycerol Stock
ELKS/RAB6-interacting/CAST family member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053204.1-2829s1c1
Sequence:CCGGCCGTCTCTTGGAAATCTTGAACTCGAGTTCAAGATTTCCAAGAGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053204.1-3379s1c1
Sequence:CCGGGATGCTAACATAGCTCTTCTACTCGAGTAGAAGAGCTATGTTAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053204.1-2419s1c1
Sequence:CCGGGCAGATAAAGAACGGACGATTCTCGAGAATCGTCCGTTCTTTATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053204.2-856s21c1
Sequence:CCGGACGCTTGCCTTACGGTGTTAGCTCGAGCTAACACCGTAAGGCAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053204.2-737s1c1
Sequence:CCGGGAGAATATACAGTCCTTAAATCTCGAGATTTAAGGACTGTATATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053204.2-7656s1c1
Sequence:CCGGGTCCATTGTTGAGAATATTAACTCGAGTTAATATTCTCAACAATGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053204.2-4460s21c1
Sequence:CCGGGGTCACCCTGATCGCTCTTTACTCGAGTAAAGAGCGATCAGGGTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053204.2-1652s21c1
Sequence:CCGGGAGGAGATGCACCGGAGATTTCTCGAGAAATCTCCGGTGCATCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053204.2-3133s1c1
Sequence:CCGGGATAACTGCAGAGCGTGAAATCTCGAGATTTCACGCTCTGCAGTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053204.2-2446s21c1
Sequence:CCGGACGGACAATTGAACGCTTAAACTCGAGTTTAAGCGTTCAATTGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053204
VALIDATED
ERC1 MISSION shRNA shRNA Plasmid DNA
ELKS/RAB6-interacting/CAST family member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053204.1-2829s1c1
Sequence:CCGGCCGTCTCTTGGAAATCTTGAACTCGAGTTCAAGATTTCCAAGAGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053204.1-3379s1c1
Sequence:CCGGGATGCTAACATAGCTCTTCTACTCGAGTAGAAGAGCTATGTTAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053204.1-2419s1c1
Sequence:CCGGGCAGATAAAGAACGGACGATTCTCGAGAATCGTCCGTTCTTTATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053204.2-856s21c1
Sequence:CCGGACGCTTGCCTTACGGTGTTAGCTCGAGCTAACACCGTAAGGCAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053204.2-737s1c1
Sequence:CCGGGAGAATATACAGTCCTTAAATCTCGAGATTTAAGGACTGTATATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053204.2-7656s1c1
Sequence:CCGGGTCCATTGTTGAGAATATTAACTCGAGTTAATATTCTCAACAATGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053204.2-4460s21c1
Sequence:CCGGGGTCACCCTGATCGCTCTTTACTCGAGTAAAGAGCGATCAGGGTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053204.2-1652s21c1
Sequence:CCGGGAGGAGATGCACCGGAGATTTCTCGAGAAATCTCCGGTGCATCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053204.2-3133s1c1
Sequence:CCGGGATAACTGCAGAGCGTGAAATCTCGAGATTTCACGCTCTGCAGTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053204.2-2446s21c1
Sequence:CCGGACGGACAATTGAACGCTTAAACTCGAGTTTAAGCGTTCAATTGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053204
VALIDATED
ERC1 MISSION shRNA Lentiviral Transduction Particles
ELKS/RAB6-interacting/CAST family member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053204.1-2829s1c1
Sequence:CCGGCCGTCTCTTGGAAATCTTGAACTCGAGTTCAAGATTTCCAAGAGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053204.1-3379s1c1
Sequence:CCGGGATGCTAACATAGCTCTTCTACTCGAGTAGAAGAGCTATGTTAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053204.1-2419s1c1
Sequence:CCGGGCAGATAAAGAACGGACGATTCTCGAGAATCGTCCGTTCTTTATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053204.2-856s21c1
Sequence:CCGGACGCTTGCCTTACGGTGTTAGCTCGAGCTAACACCGTAAGGCAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053204.2-737s1c1
Sequence:CCGGGAGAATATACAGTCCTTAAATCTCGAGATTTAAGGACTGTATATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053204.2-7656s1c1
Sequence:CCGGGTCCATTGTTGAGAATATTAACTCGAGTTAATATTCTCAACAATGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053204.2-4460s21c1
Sequence:CCGGGGTCACCCTGATCGCTCTTTACTCGAGTAAAGAGCGATCAGGGTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053204.2-1652s21c1
Sequence:CCGGGAGGAGATGCACCGGAGATTTCTCGAGAAATCTCCGGTGCATCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053204.2-3133s1c1
Sequence:CCGGGATAACTGCAGAGCGTGAAATCTCGAGATTTCACGCTCTGCAGTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053204.2-2446s21c1
Sequence:CCGGACGGACAATTGAACGCTTAAACTCGAGTTTAAGCGTTCAATTGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)