EMAIL THIS PAGE TO A FRIEND

ERC2

ELKS/RAB6-interacting/CAST family member 2

228 Gene Product Result for
Synonyms: CAST CAST1 ELKSL SPBC110 Spc110
UniProtKB ID: O15083, Q2T9F6, Q86TK4
Gene ID:
Mouse(238988) ELKS/RAB6-interacting/CAST family member 2
Rat(259269) ELKS/RAB6-interacting/CAST family member 2
chicken(769533) ELKS/RAB6-interacting/CAST family member 2
dog(484720) ELKS/RAB6-interacting/CAST family member 2
Horse(100051111) ELKS/RAB6-interacting/CAST family member 2
cow(537173) ELKS/RAB6-interacting/CAST family member 2
domestic cat(101094913) ELKS/RAB6-interacting/CAST family member 2
domestic guinea pig(100723336) ELKS/RAB6-interacting/CAST family member 2
naked mole-rat(101707682) ELKS/RAB6-interacting/CAST family member 2
sheep(101105111) ELKS/RAB6-interacting/CAST family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015576 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160201 MISSION® esiRNA esiRNA human ERC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015576 Rosetta Predictions human pricing
NM_170787 Rosetta Predictions rat pricing
NM_177814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179005 predicted 2290
2 SASI_Hs01_00179007 predicted 435
3 SASI_Hs02_00348160 predicted 2179
4 SASI_Hs01_00179008 predicted 1106
5 SASI_Hs02_00348161 predicted 919
6 SASI_Hs01_00179009 predicted 931
7 SASI_Hs01_00179010 predicted 403
8 SASI_Hs01_00179011 predicted 2042
9 SASI_Hs01_00179013 predicted 1979
10 SASI_Hs01_00179014 predicted 1190
11 SASI_Hs01_00179006 predicted 1449
12 SASI_Hs01_00179012 predicted 2660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053564 predicted 1763
2 SASI_Rn01_00053565 predicted 202
3 SASI_Rn01_00053566 predicted 1693
4 SASI_Rn01_00053567 predicted 1844
5 SASI_Rn01_00053568 predicted 1839
6 SASI_Rn02_00269065 predicted 1738
7 SASI_Rn01_00053569 predicted 1426
8 SASI_Rn02_00269066 predicted 1848
9 SASI_Rn01_00053570 predicted 1507
10 SASI_Rn01_00053572 predicted 323
11 SASI_Rn01_00053571 predicted 1831
12 SASI_Rn01_00053573 predicted 2226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036747 predicted 2400
2 SASI_Mm01_00036748 predicted 2662
3 SASI_Mm01_00036749 predicted 2147
4 SASI_Mm01_00036750 predicted 2567
5 SASI_Mm01_00036751 predicted 1845
6 SASI_Mm01_00036752 predicted 2300
7 SASI_Mm01_00036753 predicted 2222
8 SASI_Mm01_00036754 predicted 1974
9 SASI_Mm01_00036755 predicted 1959
10 SASI_Mm01_00036756 predicted 1613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177814
ERC2 MISSION shRNA Bacterial Glycerol Stock
ELKS/RAB6-interacting/CAST family member 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177814.4-3189s21c1
Sequence:CCGGGCAGTATCCTGATAATCTATTCTCGAGAATAGATTATCAGGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177814.4-3050s1c1
Sequence:CCGGGATGAAGACCATCACCATTACCTCGAGGTAATGGTGATGGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177814.4-1211s21c1
Sequence:CCGGGCCCGAGACGAGTCCATTAAACTCGAGTTTAATGGACTCGTCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177814.4-3727s21c1
Sequence:CCGGCACATTGAACAACGGTATTATCTCGAGATAATACCGTTGTTCAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177814.4-452s21c1
Sequence:CCGGGAGAATATCCAGTCCCTTAATCTCGAGATTAAGGGACTGGATATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177814.4-2349s21c1
Sequence:CCGGACAAACTGGAGGCACAATTAACTCGAGTTAATTGTGCCTCCAGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177814.3-2597s1c1
Sequence:CCGGGCCAACCTCAAGTACAACCAACTCGAGTTGGTTGTACTTGAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177814.3-4090s1c1
Sequence:CCGGCCTCTAAATGAAAGGTCACTTCTCGAGAAGTGACCTTTCATTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177814.3-4790s1c1
Sequence:CCGGGCTTCATTCTTGTCAGTAAATCTCGAGATTTACTGACAAGAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177814.3-1894s1c1
Sequence:CCGGCCGTGATATGAAAGATATGTTCTCGAGAACATATCTTTCATATCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177814.3-465s1c1
Sequence:CCGGCCCTTAATGCAGCCTATGCTACTCGAGTAGCATAGGCTGCATTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197515    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177814.3-5237s1c1
Sequence:CCGGCGATCTTACAAGCATATCATTCTCGAGAATGATATGCTTGTAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177814.3-1656s1c1
Sequence:CCGGCAGAACTTCTTGCCTTACAAACTCGAGTTTGTAAGGCAAGAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177814
ERC2 MISSION shRNA shRNA Plasmid DNA
ELKS/RAB6-interacting/CAST family member 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177814.4-3189s21c1
Sequence:CCGGGCAGTATCCTGATAATCTATTCTCGAGAATAGATTATCAGGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177814.4-3050s1c1
Sequence:CCGGGATGAAGACCATCACCATTACCTCGAGGTAATGGTGATGGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177814.4-1211s21c1
Sequence:CCGGGCCCGAGACGAGTCCATTAAACTCGAGTTTAATGGACTCGTCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177814.4-3727s21c1
Sequence:CCGGCACATTGAACAACGGTATTATCTCGAGATAATACCGTTGTTCAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177814.4-452s21c1
Sequence:CCGGGAGAATATCCAGTCCCTTAATCTCGAGATTAAGGGACTGGATATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177814.4-2349s21c1
Sequence:CCGGACAAACTGGAGGCACAATTAACTCGAGTTAATTGTGCCTCCAGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177814.3-2597s1c1
Sequence:CCGGGCCAACCTCAAGTACAACCAACTCGAGTTGGTTGTACTTGAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177814.3-4090s1c1
Sequence:CCGGCCTCTAAATGAAAGGTCACTTCTCGAGAAGTGACCTTTCATTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177814.3-4790s1c1
Sequence:CCGGGCTTCATTCTTGTCAGTAAATCTCGAGATTTACTGACAAGAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177814.3-1894s1c1
Sequence:CCGGCCGTGATATGAAAGATATGTTCTCGAGAACATATCTTTCATATCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177814.3-465s1c1
Sequence:CCGGCCCTTAATGCAGCCTATGCTACTCGAGTAGCATAGGCTGCATTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197515    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177814.3-5237s1c1
Sequence:CCGGCGATCTTACAAGCATATCATTCTCGAGAATGATATGCTTGTAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177814.3-1656s1c1
Sequence:CCGGCAGAACTTCTTGCCTTACAAACTCGAGTTTGTAAGGCAAGAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177814
ERC2 MISSION shRNA Lentiviral Transduction Particles
ELKS/RAB6-interacting/CAST family member 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177814.4-3189s21c1
Sequence:CCGGGCAGTATCCTGATAATCTATTCTCGAGAATAGATTATCAGGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177814.4-3050s1c1
Sequence:CCGGGATGAAGACCATCACCATTACCTCGAGGTAATGGTGATGGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177814.4-1211s21c1
Sequence:CCGGGCCCGAGACGAGTCCATTAAACTCGAGTTTAATGGACTCGTCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177814.4-3727s21c1
Sequence:CCGGCACATTGAACAACGGTATTATCTCGAGATAATACCGTTGTTCAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177814.4-452s21c1
Sequence:CCGGGAGAATATCCAGTCCCTTAATCTCGAGATTAAGGGACTGGATATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177814.4-2349s21c1
Sequence:CCGGACAAACTGGAGGCACAATTAACTCGAGTTAATTGTGCCTCCAGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177814.3-2597s1c1
Sequence:CCGGGCCAACCTCAAGTACAACCAACTCGAGTTGGTTGTACTTGAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177814.3-4090s1c1
Sequence:CCGGCCTCTAAATGAAAGGTCACTTCTCGAGAAGTGACCTTTCATTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177814.3-4790s1c1
Sequence:CCGGGCTTCATTCTTGTCAGTAAATCTCGAGATTTACTGACAAGAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177814.3-1894s1c1
Sequence:CCGGCCGTGATATGAAAGATATGTTCTCGAGAACATATCTTTCATATCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177814.3-465s1c1
Sequence:CCGGCCCTTAATGCAGCCTATGCTACTCGAGTAGCATAGGCTGCATTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197515    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177814.3-5237s1c1
Sequence:CCGGCGATCTTACAAGCATATCATTCTCGAGAATGATATGCTTGTAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177814.3-1656s1c1
Sequence:CCGGCAGAACTTCTTGCCTTACAAACTCGAGTTTGTAAGGCAAGAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015576
ERC2 MISSION shRNA Bacterial Glycerol Stock
ELKS/RAB6-interacting/CAST family member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015576.1-1499s1c1
Sequence:CCGGCGCGAAGAAGAGATCAAACAACTCGAGTTGTTTGATCTCTTCTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015576.1-2052s1c1
Sequence:CCGGGCTTGAAAGAACAGCGAGAAACTCGAGTTTCTCGCTGTTCTTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015576.1-1154s1c1
Sequence:CCGGGCCCGAGATGAGTCAATTAAACTCGAGTTTAATTGACTCATCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015576.1-5852s1c1
Sequence:CCGGCCTCGTTTGATAGTGCTTCTTCTCGAGAAGAAGCACTATCAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015576.1-596s1c1
Sequence:CCGGGTCCTTTCATACACAGATCAACTCGAGTTGATCTGTGTATGAAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015576.1-1610s1c1
Sequence:CCGGGCCTTACAAACAAAGCTTGAACTCGAGTTCAAGCTTTGTTTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015576.1-4857s1c1
Sequence:CCGGGCTTTGTTCTTGTCATCAGTACTCGAGTACTGATGACAAGAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015576
ERC2 MISSION shRNA shRNA Plasmid DNA
ELKS/RAB6-interacting/CAST family member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015576.1-1499s1c1
Sequence:CCGGCGCGAAGAAGAGATCAAACAACTCGAGTTGTTTGATCTCTTCTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015576.1-2052s1c1
Sequence:CCGGGCTTGAAAGAACAGCGAGAAACTCGAGTTTCTCGCTGTTCTTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015576.1-1154s1c1
Sequence:CCGGGCCCGAGATGAGTCAATTAAACTCGAGTTTAATTGACTCATCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015576.1-5852s1c1
Sequence:CCGGCCTCGTTTGATAGTGCTTCTTCTCGAGAAGAAGCACTATCAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015576.1-596s1c1
Sequence:CCGGGTCCTTTCATACACAGATCAACTCGAGTTGATCTGTGTATGAAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015576.1-1610s1c1
Sequence:CCGGGCCTTACAAACAAAGCTTGAACTCGAGTTCAAGCTTTGTTTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015576.1-4857s1c1
Sequence:CCGGGCTTTGTTCTTGTCATCAGTACTCGAGTACTGATGACAAGAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015576
ERC2 MISSION shRNA Lentiviral Transduction Particles
ELKS/RAB6-interacting/CAST family member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015576.1-1499s1c1
Sequence:CCGGCGCGAAGAAGAGATCAAACAACTCGAGTTGTTTGATCTCTTCTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015576.1-2052s1c1
Sequence:CCGGGCTTGAAAGAACAGCGAGAAACTCGAGTTTCTCGCTGTTCTTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015576.1-1154s1c1
Sequence:CCGGGCCCGAGATGAGTCAATTAAACTCGAGTTTAATTGACTCATCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015576.1-5852s1c1
Sequence:CCGGCCTCGTTTGATAGTGCTTCTTCTCGAGAAGAAGCACTATCAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015576.1-596s1c1
Sequence:CCGGGTCCTTTCATACACAGATCAACTCGAGTTGATCTGTGTATGAAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015576.1-1610s1c1
Sequence:CCGGGCCTTACAAACAAAGCTTGAACTCGAGTTCAAGCTTTGTTTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015576.1-4857s1c1
Sequence:CCGGGCTTTGTTCTTGTCATCAGTACTCGAGTACTGATGACAAGAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks