EMAIL THIS PAGE TO A FRIEND

ERCC1

excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)

91 Gene Product Result for
Synonyms: COFS4 RAD10 UV20
UniProtKB ID: P07992, Q7Z7F5, Q96S40
Gene ID:
Human(2067) Summary: The product of this gene functions in the nucleotide excision repair pathway, and is required for the repair of DNA lesions such as those induced by UV light or formed by electrophilic compounds including cisplatin. The encoded protein forms a heterodimer with the XPF endonuclease (also known as ERCC4), and the heterodimeric endonuclease catalyzes the 5' incision in the process of excising the DNA lesion. The heterodimeric endonuclease is also involved in recombinational DNA repair and in the repair of inter-strand crosslinks. Mutations in this gene result in cerebrooculofacioskeletal syndrome, and polymorphisms that alter expression of this gene may play a role in carcinogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. The last exon of this gene overlaps with the CD3e molecule, epsilon associated protein gene on the opposite strand. [provided by RefSeq, Oct 2009]
Mouse(13870) excision repair cross-complementing rodent repair deficiency, complementation group 1
Rat(292673) excision repair cross-complementing rodent repair deficiency, complementation group 1
Zebrafish(100001425) excision repair cross-complementing rodent repair deficiency, complementation group 1
cow(615637) excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
domestic cat(101095455) excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
dog(612282) excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
Thale Cress(819685) DNA excision repair protein ERCC-1
fruit fly(36654) CG10215 gene product from transcript CG10215-RA
sheep(101116856) excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
naked mole-rat(101699727) excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
domestic guinea pig(100734416) excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E5284 Anti-ERCC1 (1-14) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
E5409 Anti-ERCC1 (286-300) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500362 Anti-ERCC1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB4500795 Anti-ERCC1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB2107155 Anti-ERCC1 antibody produced in rabbit affinity isolated antibody horse, human, mouse, guinea pig, rabbit
ELISA, western blot pricing
HPA050182 Anti-ERCC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB5500100 Anti-ERCC1 antibody, Rabbit monoclonal clone SP68, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
WH0002067M1 Monoclonal Anti-ERCC1 antibody produced in mouse clone 3A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB90871 Monoclonal Anti-ERCC1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1249, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry pricing
AMAB90872 Monoclonal Anti-ERCC1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1284, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4100416 Monoclonal Anti-ERCC1 antibody produced in mouse clone ERCC1-A137, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001983 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001983 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001983 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001127324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001127324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001127324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001983 Rosetta Predictions human pricing
NM_202001 Rosetta Predictions human pricing
NM_001106228 Rosetta Predictions rat pricing
NM_001127324 Rosetta Predictions mouse pricing
NM_007948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062755 predicted 513
2 SASI_Hs01_00062756 predicted 490
3 SASI_Hs01_00062757 predicted 525
4 SASI_Hs01_00062758 predicted 748
5 SASI_Hs01_00062759 predicted 476
6 SASI_Hs01_00062760 predicted 516
7 SASI_Hs01_00062762 predicted 466
8 SASI_Hs01_00062763 predicted 686
9 SASI_Hs02_00332965 predicted 577
10 SASI_Hs01_00062764 predicted 501
11 SASI_Hs01_00062761 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_202001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227569 predicted 539
2 SASI_Hs01_00227570 predicted 511
3 SASI_Hs01_00227571 predicted 544
4 SASI_Hs01_00227572 predicted 767
5 SASI_Hs01_00227573 predicted 502
6 SASI_Hs01_00227574 predicted 535
7 SASI_Hs01_00227576 predicted 488
8 SASI_Hs01_00227577 predicted 711
9 SASI_Hs02_00373180 predicted 593
10 SASI_Hs01_00227578 predicted 525
11 SASI_Hs01_00227575 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216898 predicted 501
2 SASI_Rn02_00216899 predicted 840
3 SASI_Rn02_00216900 predicted 751
4 SASI_Rn02_00216901 predicted 512
5 SASI_Rn02_00216902 predicted 347
6 SASI_Rn02_00216903 predicted 450
7 SASI_Rn02_00216904 predicted 295
8 SASI_Rn02_00216905 predicted 771
9 SASI_Rn02_00216906 predicted 487
10 SASI_Rn02_00216907 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310227 predicted 466
2 SASI_Mm02_00310228 predicted 515
3 SASI_Mm02_00310229 predicted 500
4 SASI_Mm02_00310230 predicted 523
5 SASI_Mm02_00310231 predicted 407
6 SASI_Mm02_00310232 predicted 468
7 SASI_Mm02_00310233 predicted 365
8 SASI_Mm02_00310234 predicted 414
9 SASI_Mm02_00310235 predicted 307
10 SASI_Mm02_00310236 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129716 predicted 461
2 SASI_Mm01_00129717 predicted 507
3 SASI_Mm01_00129718 predicted 498
4 SASI_Mm01_00129719 predicted 531
5 SASI_Mm01_00129720 predicted 414
6 SASI_Mm02_00312814 predicted 461
7 SASI_Mm01_00129721 predicted 366
8 SASI_Mm02_00312815 predicted 413
9 SASI_Mm01_00129722 predicted 300
10 SASI_Mm01_00129725 predicted 487
11 SASI_Mm01_00129723 predicted 642
12 SASI_Mm01_00129724 predicted 812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001983
VALIDATED
ERCC1 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-253s1c1
Sequence:CCGGCCAAGCCCTTATTCCGATCTACTCGAGTAGATCGGAATAAGGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-946s1c1
Sequence:CCGGCAAGAGAAGATCTGGCCTTATCTCGAGATAAGGCCAGATCTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-505s1c1
Sequence:CCGGCCTGGGAATTTGGCGACGTAACTCGAGTTACGTCGCCAAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-698s1c1
Sequence:CCGGGCTGGCTAAGATGTGTATCCTCTCGAGAGGATACACATCTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-191s1c1
Sequence:CCGGGCCGCCAGCAAGGAAGAAATTCTCGAGAATTTCTTCCTTGCTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001983.2-698s21c1
Sequence:CCGGGCTGGCTAAGATGTGTATCCTCTCGAGAGGATACACATCTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001983.2-253s21c1
Sequence:CCGGCCAAGCCCTTATTCCGATCTACTCGAGTAGATCGGAATAAGGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001983.2-191s21c1
Sequence:CCGGGCCGCCAGCAAGGAAGAAATTCTCGAGAATTTCTTCCTTGCTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001983.2-946s21c1
Sequence:CCGGCAAGAGAAGATCTGGCCTTATCTCGAGATAAGGCCAGATCTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001983
VALIDATED
ERCC1 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-253s1c1
Sequence:CCGGCCAAGCCCTTATTCCGATCTACTCGAGTAGATCGGAATAAGGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-946s1c1
Sequence:CCGGCAAGAGAAGATCTGGCCTTATCTCGAGATAAGGCCAGATCTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-505s1c1
Sequence:CCGGCCTGGGAATTTGGCGACGTAACTCGAGTTACGTCGCCAAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-698s1c1
Sequence:CCGGGCTGGCTAAGATGTGTATCCTCTCGAGAGGATACACATCTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-191s1c1
Sequence:CCGGGCCGCCAGCAAGGAAGAAATTCTCGAGAATTTCTTCCTTGCTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001983.2-698s21c1
Sequence:CCGGGCTGGCTAAGATGTGTATCCTCTCGAGAGGATACACATCTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001983.2-253s21c1
Sequence:CCGGCCAAGCCCTTATTCCGATCTACTCGAGTAGATCGGAATAAGGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001983.2-191s21c1
Sequence:CCGGGCCGCCAGCAAGGAAGAAATTCTCGAGAATTTCTTCCTTGCTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001983.2-946s21c1
Sequence:CCGGCAAGAGAAGATCTGGCCTTATCTCGAGATAAGGCCAGATCTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001983
VALIDATED
ERCC1 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-253s1c1
Sequence:CCGGCCAAGCCCTTATTCCGATCTACTCGAGTAGATCGGAATAAGGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-946s1c1
Sequence:CCGGCAAGAGAAGATCTGGCCTTATCTCGAGATAAGGCCAGATCTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-505s1c1
Sequence:CCGGCCTGGGAATTTGGCGACGTAACTCGAGTTACGTCGCCAAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-698s1c1
Sequence:CCGGGCTGGCTAAGATGTGTATCCTCTCGAGAGGATACACATCTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001983.2-191s1c1
Sequence:CCGGGCCGCCAGCAAGGAAGAAATTCTCGAGAATTTCTTCCTTGCTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001983.2-698s21c1
Sequence:CCGGGCTGGCTAAGATGTGTATCCTCTCGAGAGGATACACATCTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001983.2-253s21c1
Sequence:CCGGCCAAGCCCTTATTCCGATCTACTCGAGTAGATCGGAATAAGGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001983.2-191s21c1
Sequence:CCGGGCCGCCAGCAAGGAAGAAATTCTCGAGAATTTCTTCCTTGCTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001983.2-946s21c1
Sequence:CCGGCAAGAGAAGATCTGGCCTTATCTCGAGATAAGGCCAGATCTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127324
ERCC1 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000238088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127324.1-1039s21c1
Sequence:CCGGCCTGTCATCTCTGCTGGAATCCTCGAGGATTCCAGCAGAGATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127324.1-820s21c1
Sequence:CCGGGAACTTCCTATCACGGGTATCCTCGAGGATACCCGTGATAGGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127324.1-759s21c1
Sequence:CCGGTGGAGACCTACAAGGCGTATGCTCGAGCATACGCCTTGTAGGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127324.1-642s21c1
Sequence:CCGGTGGTTCAAGTGGATGTGAAAGCTCGAGCTTTCACATCCACTTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127324
ERCC1 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000238088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127324.1-1039s21c1
Sequence:CCGGCCTGTCATCTCTGCTGGAATCCTCGAGGATTCCAGCAGAGATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127324.1-820s21c1
Sequence:CCGGGAACTTCCTATCACGGGTATCCTCGAGGATACCCGTGATAGGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127324.1-759s21c1
Sequence:CCGGTGGAGACCTACAAGGCGTATGCTCGAGCATACGCCTTGTAGGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127324.1-642s21c1
Sequence:CCGGTGGTTCAAGTGGATGTGAAAGCTCGAGCTTTCACATCCACTTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127324
ERCC1 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000238088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127324.1-1039s21c1
Sequence:CCGGCCTGTCATCTCTGCTGGAATCCTCGAGGATTCCAGCAGAGATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127324.1-820s21c1
Sequence:CCGGGAACTTCCTATCACGGGTATCCTCGAGGATACCCGTGATAGGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127324.1-759s21c1
Sequence:CCGGTGGAGACCTACAAGGCGTATGCTCGAGCATACGCCTTGTAGGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127324.1-642s21c1
Sequence:CCGGTGGTTCAAGTGGATGTGAAAGCTCGAGCTTTCACATCCACTTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks