EMAIL THIS PAGE TO A FRIEND

ERCC3

excision repair cross-complementing rodent repair deficiency, complementation group 3

64 Gene Product Result for
Synonyms: BTF2 GTF2H RAD25 TFIIH XPB
UniProtKB ID: P19447, Q53QM0
Gene ID:
Human(2071) Summary: ERCC3 is an ATP-dependent DNA helicase that functions in nucleotide excision repair and complements xeroderma pigmentosum group B mutations. It also is the 89 kDa subunit of basal transcription factor 2 (TFIIH) and thus functions in class II transcription. [provided by RefSeq, Jul 2008]
Mouse(13872) excision repair cross-complementing rodent repair deficiency, complementation group 3
Rat(291703) excision repair cross-complementing rodent repair deficiency, complementation group 3
Zebrafish(324323) excision repair cross-complementing rodent repair deficiency, complementation group 3
cow(507984) excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)
domestic cat(101096662) excision repair cross-complementing rodent repair deficiency, complementation group 3
chicken(424226) excision repair cross-complementing rodent repair deficiency, complementation group 3
dog(476105) excision repair cross-complementing rodent repair deficiency, complementation group 3
sheep(101110119) excision repair cross-complementing rodent repair deficiency, complementation group 3
Domestic Rabbit(100348395) excision repair cross-complementing rodent repair deficiency, complementation group 3
naked mole-rat(101725837) excision repair cross-complementing rodent repair deficiency, complementation group 3
domestic guinea pig(100717787) excision repair cross-complementing rodent repair deficiency, complementation group 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000122 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133658 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133658 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133658 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000122 Rosetta Predictions human pricing
NM_001031644 Rosetta Predictions rat pricing
NM_133658 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170293 predicted 1825
2 SASI_Hs02_00301913 predicted 2129
3 SASI_Hs01_00170294 predicted 677
4 SASI_Hs01_00170295 predicted 1469
5 SASI_Hs01_00170296 predicted 1676
6 SASI_Hs01_00170297 predicted 983
7 SASI_Hs01_00170298 predicted 2428
8 SASI_Hs01_00170301 predicted 968
9 SASI_Hs02_00301914 predicted 552
10 SASI_Hs02_00301915 predicted 711
11 SASI_Hs01_00170299 predicted 1758
12 SASI_Hs01_00170300 predicted 1651
13 SASI_Hs01_00170302 predicted 1783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070320 predicted 483
2 SASI_Rn01_00070322 predicted 1414
3 SASI_Rn01_00070323 predicted 2079
4 SASI_Rn01_00070324 predicted 319
5 SASI_Rn01_00070325 predicted 1695
6 SASI_Rn01_00070326 predicted 1855
7 SASI_Rn01_00070327 predicted 1756
8 SASI_Rn01_00070328 predicted 2045
9 SASI_Rn01_00070329 predicted 557
10 SASI_Rn02_00203579 predicted 1668
11 SASI_Rn01_00070321 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338588 predicted 465
2 SASI_Mm01_00193860 predicted 941
3 SASI_Mm01_00193862 predicted 1582
4 SASI_Mm01_00193863 predicted 210
5 SASI_Mm02_00338589 predicted 1749
6 SASI_Mm01_00193864 predicted 509
7 SASI_Mm01_00193866 predicted 2120
8 SASI_Mm01_00193867 predicted 1039
9 SASI_Mm01_00193868 predicted 1695
10 SASI_Mm01_00193869 predicted 955
11 SASI_Mm01_00193861 predicted 1450
12 SASI_Mm01_00193865 predicted 1722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000122
ERCC3 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-1947s1c1
Sequence:CCGGCCGGAAGCAAATGTCCTCATTCTCGAGAATGAGGACATTTGCTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-1653s1c1
Sequence:CCGGCGGGAATATGTGGCAATCAAACTCGAGTTTGATTGCCACATATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-750s1c1
Sequence:CCGGGCCATTTCTAAGACTGCTGAACTCGAGTTCAGCAGTCTTAGAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-366s1c1
Sequence:CCGGCCAGTTTACAAATATGCCCAACTCGAGTTGGGCATATTTGTAAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-1794s1c1
Sequence:CCGGGCCCTAAAGGAATATGCCATTCTCGAGAATGGCATATTCCTTTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000122.1-2131s21c1
Sequence:CCGGTCTTGGTAGATCAAGGTTATACTCGAGTATAACCTTGATCTACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000122.1-674s21c1
Sequence:CCGGGATCCGAGAATGCCGCTTAAGCTCGAGCTTAAGCGGCATTCTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000122.1-2416s21c1
Sequence:CCGGACCCGCTCTTCAAGCGCTTTACTCGAGTAAAGCGCTTGAAGAGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000122.1-1815s21c1
Sequence:CCGGCGACTGAACAAACCCTATATCCTCGAGGATATAGGGTTTGTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000122
ERCC3 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-1947s1c1
Sequence:CCGGCCGGAAGCAAATGTCCTCATTCTCGAGAATGAGGACATTTGCTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-1653s1c1
Sequence:CCGGCGGGAATATGTGGCAATCAAACTCGAGTTTGATTGCCACATATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-750s1c1
Sequence:CCGGGCCATTTCTAAGACTGCTGAACTCGAGTTCAGCAGTCTTAGAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-366s1c1
Sequence:CCGGCCAGTTTACAAATATGCCCAACTCGAGTTGGGCATATTTGTAAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-1794s1c1
Sequence:CCGGGCCCTAAAGGAATATGCCATTCTCGAGAATGGCATATTCCTTTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000122.1-2131s21c1
Sequence:CCGGTCTTGGTAGATCAAGGTTATACTCGAGTATAACCTTGATCTACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000122.1-674s21c1
Sequence:CCGGGATCCGAGAATGCCGCTTAAGCTCGAGCTTAAGCGGCATTCTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000122.1-2416s21c1
Sequence:CCGGACCCGCTCTTCAAGCGCTTTACTCGAGTAAAGCGCTTGAAGAGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000122.1-1815s21c1
Sequence:CCGGCGACTGAACAAACCCTATATCCTCGAGGATATAGGGTTTGTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000122
ERCC3 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-1947s1c1
Sequence:CCGGCCGGAAGCAAATGTCCTCATTCTCGAGAATGAGGACATTTGCTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-1653s1c1
Sequence:CCGGCGGGAATATGTGGCAATCAAACTCGAGTTTGATTGCCACATATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-750s1c1
Sequence:CCGGGCCATTTCTAAGACTGCTGAACTCGAGTTCAGCAGTCTTAGAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-366s1c1
Sequence:CCGGCCAGTTTACAAATATGCCCAACTCGAGTTGGGCATATTTGTAAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000122.1-1794s1c1
Sequence:CCGGGCCCTAAAGGAATATGCCATTCTCGAGAATGGCATATTCCTTTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000122.1-2131s21c1
Sequence:CCGGTCTTGGTAGATCAAGGTTATACTCGAGTATAACCTTGATCTACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000122.1-674s21c1
Sequence:CCGGGATCCGAGAATGCCGCTTAAGCTCGAGCTTAAGCGGCATTCTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000122.1-2416s21c1
Sequence:CCGGACCCGCTCTTCAAGCGCTTTACTCGAGTAAAGCGCTTGAAGAGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000122.1-1815s21c1
Sequence:CCGGCGACTGAACAAACCCTATATCCTCGAGGATATAGGGTTTGTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133658
VALIDATED
ERCC3 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-2456s1c1
Sequence:CCGGCGTGTTGAAGAGAGACTTCTTCTCGAGAAGAAGTCTCTCTTCAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-607s1c1
Sequence:CCGGCCTGATGTTATCCAGCATCTTCTCGAGAAGATGCTGGATAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-1624s1c1
Sequence:CCGGCGAGAGTATGTGGCAATCAAACTCGAGTTTGATTGCCACATACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-872s1c1
Sequence:CCGGCCTTTGAAGTTAAGCAGGAAACTCGAGTTTCCTGCTTAACTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-508s1c1
Sequence:CCGGCCTGATGGAATTATCCAGTTTCTCGAGAAACTGGATAATTCCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133658.1-1786s21c1
Sequence:CCGGCGGCTGAACAAACCTTATATCCTCGAGGATATAAGGTTTGTTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133658.1-1613s21c1
Sequence:CCGGCCGAGTTCTACCGAGAGTATGCTCGAGCATACTCTCGGTAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133658.1-2482s21c1
Sequence:CCGGACCGGTGTGATCGTTTCTATCCTCGAGGATAGAAACGATCACACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133658.1-872s21c1
Sequence:CCGGCCTTTGAAGTTAAGCAGGAAACTCGAGTTTCCTGCTTAACTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133658.1-1744s21c1
Sequence:CCGGGTCTTTGCTGACAACGTATTTCTCGAGAAATACGTTGTCAGCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133658
VALIDATED
ERCC3 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-2456s1c1
Sequence:CCGGCGTGTTGAAGAGAGACTTCTTCTCGAGAAGAAGTCTCTCTTCAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-607s1c1
Sequence:CCGGCCTGATGTTATCCAGCATCTTCTCGAGAAGATGCTGGATAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-1624s1c1
Sequence:CCGGCGAGAGTATGTGGCAATCAAACTCGAGTTTGATTGCCACATACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-872s1c1
Sequence:CCGGCCTTTGAAGTTAAGCAGGAAACTCGAGTTTCCTGCTTAACTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-508s1c1
Sequence:CCGGCCTGATGGAATTATCCAGTTTCTCGAGAAACTGGATAATTCCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133658.1-1786s21c1
Sequence:CCGGCGGCTGAACAAACCTTATATCCTCGAGGATATAAGGTTTGTTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133658.1-1613s21c1
Sequence:CCGGCCGAGTTCTACCGAGAGTATGCTCGAGCATACTCTCGGTAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133658.1-2482s21c1
Sequence:CCGGACCGGTGTGATCGTTTCTATCCTCGAGGATAGAAACGATCACACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133658.1-872s21c1
Sequence:CCGGCCTTTGAAGTTAAGCAGGAAACTCGAGTTTCCTGCTTAACTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133658.1-1744s21c1
Sequence:CCGGGTCTTTGCTGACAACGTATTTCTCGAGAAATACGTTGTCAGCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133658
VALIDATED
ERCC3 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-2456s1c1
Sequence:CCGGCGTGTTGAAGAGAGACTTCTTCTCGAGAAGAAGTCTCTCTTCAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-607s1c1
Sequence:CCGGCCTGATGTTATCCAGCATCTTCTCGAGAAGATGCTGGATAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-1624s1c1
Sequence:CCGGCGAGAGTATGTGGCAATCAAACTCGAGTTTGATTGCCACATACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-872s1c1
Sequence:CCGGCCTTTGAAGTTAAGCAGGAAACTCGAGTTTCCTGCTTAACTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133658.1-508s1c1
Sequence:CCGGCCTGATGGAATTATCCAGTTTCTCGAGAAACTGGATAATTCCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133658.1-1786s21c1
Sequence:CCGGCGGCTGAACAAACCTTATATCCTCGAGGATATAAGGTTTGTTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133658.1-1613s21c1
Sequence:CCGGCCGAGTTCTACCGAGAGTATGCTCGAGCATACTCTCGGTAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133658.1-2482s21c1
Sequence:CCGGACCGGTGTGATCGTTTCTATCCTCGAGGATAGAAACGATCACACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133658.1-872s21c1
Sequence:CCGGCCTTTGAAGTTAAGCAGGAAACTCGAGTTTCCTGCTTAACTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133658.1-1744s21c1
Sequence:CCGGGTCTTTGCTGACAACGTATTTCTCGAGAAATACGTTGTCAGCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks