EMAIL THIS PAGE TO A FRIEND

ERCC4

excision repair cross-complementing rodent repair deficiency, complementation group 4

47 Gene Product Result for
Synonyms: ERCC11 FANCQ RAD1 XPF
UniProtKB ID: Q92889, A8K111, O00140, Q8TD83
Gene ID:
Human(2072) Summary: The protein encoded by this gene forms a complex with ERCC1 and is involved in the 5' incision made during nucleotide excision repair. This complex is a structure specific DNA repair endonuclease that interacts with EME1. Defects in this gene are a cause of xeroderma pigmentosum complementation group F (XP-F), or xeroderma pigmentosum VI (XP6).[provided by RefSeq, Mar 2009]
Mouse(50505) excision repair cross-complementing rodent repair deficiency, complementation group 4
Rat(304719) excision repair cross-complementing rodent repair deficiency, complementation group 4
domestic guinea pig(100731330) excision repair cross-complementing rodent repair deficiency, complementation group 4
naked mole-rat(101717694) excision repair cross-complementing rodent repair deficiency, complementation group 4
sheep(101109669) excision repair cross-complementing rodent repair deficiency, complementation group 4
Domestic Rabbit(100350642) excision repair cross-complementing rodent repair deficiency, complementation group 4
Zebrafish(327322) excision repair cross-complementing rodent repair deficiency, complementation group 4
cow(516371) excision repair cross-complementing rodent repair deficiency, complementation group 4
Horse(100050812) excision repair cross-complementing rodent repair deficiency, complementation group 4
chicken(416420) excision repair cross-complementing rodent repair deficiency, complementation group 4
dog(479842) excision repair cross-complementing rodent repair deficiency, complementation group 4
domestic cat(101100531) excision repair cross-complementing rodent repair deficiency, complementation group 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005236 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005236 Rosetta Predictions human pricing
XM_222534 Rosetta Predictions rat pricing
NM_015769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108955 predicted 617
2 SASI_Hs01_00108956 predicted 337
3 SASI_Hs01_00108958 predicted 1483
4 SASI_Hs01_00108959 predicted 727
5 SASI_Hs01_00108960 predicted 588
6 SASI_Hs01_00108961 predicted 378
7 SASI_Hs01_00108962 predicted 289
8 SASI_Hs01_00108963 predicted 2422
9 SASI_Hs01_00108964 predicted 2058
10 SASI_Hs02_00339243 predicted 583
11 SASI_Hs01_00108957 predicted 2341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380785 predicted 2419
2 SASI_Rn02_00380786 predicted 1541
3 SASI_Rn02_00380787 predicted 908
4 SASI_Rn02_00380788 predicted 1443
5 SASI_Rn02_00380789 predicted 836
6 SASI_Rn02_00380790 predicted 2939
7 SASI_Rn02_00380791 predicted 1760
8 SASI_Rn02_00380792 predicted 1083
9 SASI_Rn02_00380793 predicted 2556
10 SASI_Rn02_00380794 predicted 1572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077588 predicted 833
2 SASI_Mm01_00077589 predicted 529
3 SASI_Mm01_00077590 predicted 1309
4 SASI_Mm02_00323101 predicted 1101
5 SASI_Mm01_00077591 predicted 1775
6 SASI_Mm01_00077592 predicted 422
7 SASI_Mm01_00077593 predicted 2965
8 SASI_Mm02_00323102 predicted 779
9 SASI_Mm01_00077594 predicted 862
10 SASI_Mm01_00077595 predicted 1083
11 SASI_Mm01_00077596 predicted 890
12 SASI_Mm01_00077597 predicted 1046
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015769
ERCC4 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015769.1-2954s21c1
Sequence:CCGGCTGTTCTCACATGGCTATTTACTCGAGTAAATAGCCATGTGAGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015769.1-499s21c1
Sequence:CCGGCTACACGCAGGGTGGTATTATCTCGAGATAATACCACCCTGCGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015769.1-532s21c1
Sequence:CCGGCCGAATACTCGTGGTTGATTTCTCGAGAAATCAACCACGAGTATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015769.1-1535s1c1
Sequence:CCGGGCTGAAGAAGTGTGGGTAAATCTCGAGATTTACCCACACTTCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015769.1-3171s1c1
Sequence:CCGGCTTGAAGTAAACACAGACTATCTCGAGATAGTCTGTGTTTACTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015769
ERCC4 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015769.1-2954s21c1
Sequence:CCGGCTGTTCTCACATGGCTATTTACTCGAGTAAATAGCCATGTGAGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015769.1-499s21c1
Sequence:CCGGCTACACGCAGGGTGGTATTATCTCGAGATAATACCACCCTGCGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015769.1-532s21c1
Sequence:CCGGCCGAATACTCGTGGTTGATTTCTCGAGAAATCAACCACGAGTATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015769.1-1535s1c1
Sequence:CCGGGCTGAAGAAGTGTGGGTAAATCTCGAGATTTACCCACACTTCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015769.1-3171s1c1
Sequence:CCGGCTTGAAGTAAACACAGACTATCTCGAGATAGTCTGTGTTTACTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015769
ERCC4 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015769.1-2954s21c1
Sequence:CCGGCTGTTCTCACATGGCTATTTACTCGAGTAAATAGCCATGTGAGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015769.1-499s21c1
Sequence:CCGGCTACACGCAGGGTGGTATTATCTCGAGATAATACCACCCTGCGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015769.1-532s21c1
Sequence:CCGGCCGAATACTCGTGGTTGATTTCTCGAGAAATCAACCACGAGTATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015769.1-1535s1c1
Sequence:CCGGGCTGAAGAAGTGTGGGTAAATCTCGAGATTTACCCACACTTCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015769.1-3171s1c1
Sequence:CCGGCTTGAAGTAAACACAGACTATCTCGAGATAGTCTGTGTTTACTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005236
VALIDATED
ERCC4 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005236.1-1468s1c2
Sequence:CCGGCGGAAGTTGACCTTAACTCAACTCGAGTTGAGTTAAGGTCAACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005236.1-2175s1c1
Sequence:CCGGGCGCAAGAGTATCAGTGATTTCTCGAGAAATCACTGATACTCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005236.1-407s1c1
Sequence:CCGGCCCACAGAATAATCGAGTCTTCTCGAGAAGACTCGATTATTCTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005236.1-666s1c1
Sequence:CCGGGCTTGCTATACAGACTGCTATCTCGAGATAGCAGTCTGTATAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005236.1-1723s1c1
Sequence:CCGGCCAAGATACGTGGTTCTTTATCTCGAGATAAAGAACCACGTATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005236
VALIDATED
ERCC4 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005236.1-1468s1c2
Sequence:CCGGCGGAAGTTGACCTTAACTCAACTCGAGTTGAGTTAAGGTCAACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005236.1-2175s1c1
Sequence:CCGGGCGCAAGAGTATCAGTGATTTCTCGAGAAATCACTGATACTCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005236.1-407s1c1
Sequence:CCGGCCCACAGAATAATCGAGTCTTCTCGAGAAGACTCGATTATTCTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005236.1-666s1c1
Sequence:CCGGGCTTGCTATACAGACTGCTATCTCGAGATAGCAGTCTGTATAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005236.1-1723s1c1
Sequence:CCGGCCAAGATACGTGGTTCTTTATCTCGAGATAAAGAACCACGTATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005236
VALIDATED
ERCC4 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005236.1-1468s1c2
Sequence:CCGGCGGAAGTTGACCTTAACTCAACTCGAGTTGAGTTAAGGTCAACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005236.1-2175s1c1
Sequence:CCGGGCGCAAGAGTATCAGTGATTTCTCGAGAAATCACTGATACTCTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005236.1-407s1c1
Sequence:CCGGCCCACAGAATAATCGAGTCTTCTCGAGAAGACTCGATTATTCTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005236.1-666s1c1
Sequence:CCGGGCTTGCTATACAGACTGCTATCTCGAGATAGCAGTCTGTATAGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005236.1-1723s1c1
Sequence:CCGGCCAAGATACGTGGTTCTTTATCTCGAGATAAAGAACCACGTATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)