EMAIL THIS PAGE TO A FRIEND

ERCC5

excision repair cross-complementing rodent repair deficiency, complementation group 5

56 Gene Product Result for
Synonyms: COFS3 ERCM2 UVDR XPG XPGC
Gene ID:
Human(2073) Summary: This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
Mouse(22592) excision repair cross-complementing rodent repair deficiency, complementation group 5
Rat(301382) excision repair cross-complementing rodent repair deficiency, complementation group 5
domestic guinea pig(100734193) excision repair cross-complementing rodent repair deficiency, complementation group 5
naked mole-rat(101723410) excision repair cross-complementing rodent repair deficiency, complementation group 5
sheep(101114031) excision repair cross-complementing rodent repair deficiency, complementation group 5
Domestic Rabbit(100338146) excision repair cross-complementing rodent repair deficiency, complementation group 5
Zebrafish(541502) excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))
cow(509602) excision repair cross-complementing rodent repair deficiency, complementation group 5
Horse(100063431) excision repair cross-complementing rodent repair deficiency, complementation group 5
domestic cat(101085685) excision repair cross-complementing rodent repair deficiency, complementation group 5
dog(485540) excision repair cross-complementing rodent repair deficiency, complementation group 5
chicken(428019) excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000123 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000123 Rosetta Predictions human pricing
NM_001106910 Rosetta Predictions rat pricing
NM_011729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068535 predicted 1912
2 SASI_Hs01_00068536 predicted 2946
3 SASI_Hs01_00068537 predicted 3412
4 SASI_Hs01_00068538 predicted 549
5 SASI_Hs01_00068539 predicted 1896
6 SASI_Hs01_00068540 predicted 1069
7 SASI_Hs01_00068541 predicted 528
8 SASI_Hs02_00301916 predicted 2837
9 SASI_Hs01_00068542 predicted 1270
10 SASI_Hs02_00301917 predicted 2182
11 SASI_Hs01_00068543 predicted 1181
12 SASI_Hs01_00068544 predicted 2079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223606 predicted 1888
2 SASI_Rn02_00223607 predicted 981
3 SASI_Rn02_00223608 predicted 1439
4 SASI_Rn02_00223609 predicted 927
5 SASI_Rn02_00223610 predicted 1511
6 SASI_Rn02_00223611 predicted 811
7 SASI_Rn02_00223612 predicted 729
8 SASI_Rn02_00223613 predicted 296
9 SASI_Rn02_00223614 predicted 958
10 SASI_Rn02_00223615 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115259 predicted 2796
2 SASI_Mm01_00115260 predicted 2728
3 SASI_Mm01_00115261 predicted 445
4 SASI_Mm01_00115262 predicted 836
5 SASI_Mm01_00115265 predicted 401
6 SASI_Mm01_00115266 predicted 1037
7 SASI_Mm01_00115267 predicted 2548
8 SASI_Mm02_00321299 predicted 2006
9 SASI_Mm02_00321300 predicted 1342
10 SASI_Mm02_00321301 predicted 1027
11 SASI_Mm01_00115258 predicted 2352
12 SASI_Mm01_00115263 predicted 746
13 SASI_Mm01_00115264 predicted 814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011729
VALIDATED
ERCC5 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011729.1-3755s1c1
Sequence:CCGGAGAAACAGAAAGTGCTTACAACTCGAGTTGTAAGCACTTTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011729.1-2384s1c1
Sequence:CCGGGCCCAACGAATGGCAAGATATCTCGAGATATCTTGCCATTCGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011729.1-2666s1c1
Sequence:CCGGCCGGCATGTCTATAAGAATTTCTCGAGAAATTCTTATAGACATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011729.1-860s1c1
Sequence:CCGGGCGAACACTGTTTGAAGCAATCTCGAGATTGCTTCAAACAGTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011729.1-1921s1c1
Sequence:CCGGGCCTTTCAAGTGACGATGAAACTCGAGTTTCATCGTCACTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011729.2-2806s21c1
Sequence:CCGGGTTTGTAGAGTACTATCAATACTCGAGTATTGATAGTACTCTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011729.2-399s21c1
Sequence:CCGGTGGCCGTGGATATTAGCATTTCTCGAGAAATGCTAATATCCACGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011729.2-3241s21c1
Sequence:CCGGATCCCTGTATCCAGTACTAAACTCGAGTTTAGTACTGGATACAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011729.2-2718s21c1
Sequence:CCGGACCAGACTTCTGGAACGATTACTCGAGTAATCGTTCCAGAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011729.2-2025s21c1
Sequence:CCGGGCCTTTCAAGTGACGATGAAACTCGAGTTTCATCGTCACTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011729
VALIDATED
ERCC5 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011729.1-3755s1c1
Sequence:CCGGAGAAACAGAAAGTGCTTACAACTCGAGTTGTAAGCACTTTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011729.1-2384s1c1
Sequence:CCGGGCCCAACGAATGGCAAGATATCTCGAGATATCTTGCCATTCGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011729.1-2666s1c1
Sequence:CCGGCCGGCATGTCTATAAGAATTTCTCGAGAAATTCTTATAGACATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011729.1-860s1c1
Sequence:CCGGGCGAACACTGTTTGAAGCAATCTCGAGATTGCTTCAAACAGTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011729.1-1921s1c1
Sequence:CCGGGCCTTTCAAGTGACGATGAAACTCGAGTTTCATCGTCACTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011729.2-2806s21c1
Sequence:CCGGGTTTGTAGAGTACTATCAATACTCGAGTATTGATAGTACTCTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011729.2-399s21c1
Sequence:CCGGTGGCCGTGGATATTAGCATTTCTCGAGAAATGCTAATATCCACGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011729.2-3241s21c1
Sequence:CCGGATCCCTGTATCCAGTACTAAACTCGAGTTTAGTACTGGATACAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011729.2-2718s21c1
Sequence:CCGGACCAGACTTCTGGAACGATTACTCGAGTAATCGTTCCAGAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011729.2-2025s21c1
Sequence:CCGGGCCTTTCAAGTGACGATGAAACTCGAGTTTCATCGTCACTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011729
VALIDATED
ERCC5 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011729.1-3755s1c1
Sequence:CCGGAGAAACAGAAAGTGCTTACAACTCGAGTTGTAAGCACTTTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011729.1-2384s1c1
Sequence:CCGGGCCCAACGAATGGCAAGATATCTCGAGATATCTTGCCATTCGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011729.1-2666s1c1
Sequence:CCGGCCGGCATGTCTATAAGAATTTCTCGAGAAATTCTTATAGACATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011729.1-860s1c1
Sequence:CCGGGCGAACACTGTTTGAAGCAATCTCGAGATTGCTTCAAACAGTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011729.1-1921s1c1
Sequence:CCGGGCCTTTCAAGTGACGATGAAACTCGAGTTTCATCGTCACTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011729.2-2806s21c1
Sequence:CCGGGTTTGTAGAGTACTATCAATACTCGAGTATTGATAGTACTCTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011729.2-399s21c1
Sequence:CCGGTGGCCGTGGATATTAGCATTTCTCGAGAAATGCTAATATCCACGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011729.2-3241s21c1
Sequence:CCGGATCCCTGTATCCAGTACTAAACTCGAGTTTAGTACTGGATACAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011729.2-2718s21c1
Sequence:CCGGACCAGACTTCTGGAACGATTACTCGAGTAATCGTTCCAGAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011729.2-2025s21c1
Sequence:CCGGGCCTTTCAAGTGACGATGAAACTCGAGTTTCATCGTCACTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000123
ERCC5 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-3289s1c1
Sequence:CCGGCCAGCGAAATAGAAGCAGTTTCTCGAGAAACTGCTTCTATTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-2115s1c1
Sequence:CCGGCCAATGGAAATTGACTCGGAACTCGAGTTCCGAGTCAATTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-3132s1c1
Sequence:CCGGCCTGTATTAAAGCAACTCGATCTCGAGATCGAGTTGCTTTAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-636s1c1
Sequence:CCGGCCTCCTTTACAAGAGGAAGAACTCGAGTTCTTCCTCTTGTAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-3419s1c1
Sequence:CCGGGCTTTCAGATTCTAAACGAAACTCGAGTTTCGTTTAGAATCTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000123.2-2973s21c1
Sequence:CCGGTTGGGATTGGACCGGAATAAGCTCGAGCTTATTCCGGTCCAATCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000123.2-1688s21c1
Sequence:CCGGAGCAGAAGAAATGCGTATAAACTCGAGTTTATACGCATTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000123.2-1902s21c1
Sequence:CCGGCCGATAAGTGATGAGTCTATGCTCGAGCATAGACTCATCACTTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000123.2-3455s21c1
Sequence:CCGGAGAAGATGCTAAACGTATTAACTCGAGTTAATACGTTTAGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000123
ERCC5 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-3289s1c1
Sequence:CCGGCCAGCGAAATAGAAGCAGTTTCTCGAGAAACTGCTTCTATTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-2115s1c1
Sequence:CCGGCCAATGGAAATTGACTCGGAACTCGAGTTCCGAGTCAATTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-3132s1c1
Sequence:CCGGCCTGTATTAAAGCAACTCGATCTCGAGATCGAGTTGCTTTAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-636s1c1
Sequence:CCGGCCTCCTTTACAAGAGGAAGAACTCGAGTTCTTCCTCTTGTAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-3419s1c1
Sequence:CCGGGCTTTCAGATTCTAAACGAAACTCGAGTTTCGTTTAGAATCTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000123.2-2973s21c1
Sequence:CCGGTTGGGATTGGACCGGAATAAGCTCGAGCTTATTCCGGTCCAATCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000123.2-1688s21c1
Sequence:CCGGAGCAGAAGAAATGCGTATAAACTCGAGTTTATACGCATTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000123.2-1902s21c1
Sequence:CCGGCCGATAAGTGATGAGTCTATGCTCGAGCATAGACTCATCACTTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000123.2-3455s21c1
Sequence:CCGGAGAAGATGCTAAACGTATTAACTCGAGTTAATACGTTTAGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000123
ERCC5 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-3289s1c1
Sequence:CCGGCCAGCGAAATAGAAGCAGTTTCTCGAGAAACTGCTTCTATTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-2115s1c1
Sequence:CCGGCCAATGGAAATTGACTCGGAACTCGAGTTCCGAGTCAATTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-3132s1c1
Sequence:CCGGCCTGTATTAAAGCAACTCGATCTCGAGATCGAGTTGCTTTAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-636s1c1
Sequence:CCGGCCTCCTTTACAAGAGGAAGAACTCGAGTTCTTCCTCTTGTAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000123.1-3419s1c1
Sequence:CCGGGCTTTCAGATTCTAAACGAAACTCGAGTTTCGTTTAGAATCTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000123.2-2973s21c1
Sequence:CCGGTTGGGATTGGACCGGAATAAGCTCGAGCTTATTCCGGTCCAATCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000123.2-1688s21c1
Sequence:CCGGAGCAGAAGAAATGCGTATAAACTCGAGTTTATACGCATTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000123.2-1902s21c1
Sequence:CCGGCCGATAAGTGATGAGTCTATGCTCGAGCATAGACTCATCACTTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000123.2-3455s21c1
Sequence:CCGGAGAAGATGCTAAACGTATTAACTCGAGTTAATACGTTTAGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks