EMAIL THIS PAGE TO A FRIEND

ERCC6

excision repair cross-complementing rodent repair deficiency, complementation group 6

95 Gene Product Result for
Synonyms: ARMD5 CKN2 COFS COFS1 CSB RAD26 UVSS1
UniProtKB ID: Q03468, D3DX94, Q5W0L9
Gene ID:
Human(2074) Summary: This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Naturally-occurring readthrough transcription occurs between this gene and the adjacent PGBD3 gene (GeneID:267004), and results in a fusion protein that shares sequence with the product of each individual gene. The readthrough locus is represented by GeneID:101243544. [provided by RefSeq, Mar 2013]
Mouse(319955) excision repair cross-complementing rodent repair deficiency, complementation group 6
Rat(306274) excision repair cross-complementing rodent repair deficiency, complementation group 6
Zebrafish(560477) excision repair cross-complementing rodent repair deficiency, complementation group 6
cow(522908) excision repair cross-complementing rodent repair deficiency, complementation group 6
Horse(100062916) excision repair cross-complementing rodent repair deficiency, complementation group 6
domestic cat(101092399) excision repair cross-complementing rodent repair deficiency, complementation group 6
dog(477747) excision repair cross-complementing rodent repair deficiency, complementation group 6
chicken(423785) excision repair cross-complementing rodent repair deficiency, complementation group 6
sheep(101117559) excision repair cross-complementing rodent repair deficiency, complementation group 6
naked mole-rat(101712293) excision repair cross-complementing rodent repair deficiency, complementation group 6
domestic guinea pig(100719487) excision repair cross-complementing rodent repair deficiency, complementation group 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000124 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177043 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177043 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177043 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000124 Rosetta Predictions human pricing
NM_001107296 Rosetta Predictions rat pricing
NM_001081221 Rosetta Predictions mouse pricing
XM_484360 Rosetta Predictions mouse pricing
XM_899129 Rosetta Predictions mouse pricing
XM_899152 Rosetta Predictions mouse pricing
XM_985464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205964 predicted 2596
2 SASI_Hs02_00301918 predicted 2538
3 SASI_Hs01_00205965 predicted 2349
4 SASI_Hs01_00205966 predicted 378
5 SASI_Hs01_00205968 predicted 3142
6 SASI_Hs01_00205969 predicted 3160
7 SASI_Hs02_00301919 predicted 967
8 SASI_Hs01_00205970 predicted 3370
9 SASI_Hs01_00205971 predicted 2365
10 SASI_Hs01_00205972 predicted 1860
11 SASI_Hs01_00205967 predicted 3719
12 SASI_Hs01_00205973 predicted 2384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227445 predicted 730
2 SASI_Rn02_00227446 predicted 1688
3 SASI_Rn02_00227447 predicted 3290
4 SASI_Rn02_00227448 predicted 788
5 SASI_Rn02_00227449 predicted 2010
6 SASI_Rn02_00227450 predicted 2343
7 SASI_Rn02_00227451 predicted 1383
8 SASI_Rn02_00227452 predicted 1464
9 SASI_Rn02_00227453 predicted 2072
10 SASI_Rn02_00227454 predicted 1908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296371 predicted 1539
2 SASI_Mm02_00296372 predicted 2077
3 SASI_Mm02_00296373 predicted 974
4 SASI_Mm02_00296374 predicted 883
5 SASI_Mm02_00296375 predicted 2375
6 SASI_Mm02_00296376 predicted 2744
7 SASI_Mm02_00296377 predicted 3576
8 SASI_Mm02_00296378 predicted 510
9 SASI_Mm02_00296379 predicted 231
10 SASI_Mm02_00296380 predicted 2279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270457 predicted 1553
2 SASI_Mm01_00270458 predicted 2080
3 SASI_Mm01_00270459 predicted 987
4 SASI_Mm01_00270460 predicted 888
5 SASI_Mm01_00270461 predicted 2386
6 SASI_Mm01_00270462 predicted 2750
7 SASI_Mm01_00270463 predicted 3574
8 SASI_Mm01_00270464 predicted 515
9 SASI_Mm01_00270465 predicted 236
10 SASI_Mm01_00270466 predicted 2282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233682 predicted 1548
2 SASI_Mm01_00233683 predicted 818
3 SASI_Mm01_00233684 predicted 983
4 SASI_Mm01_00233685 predicted 891
5 SASI_Mm01_00233686 predicted 1673
6 SASI_Mm01_00233687 predicted 1704
7 SASI_Mm01_00233688 predicted 515
8 SASI_Mm01_00233689 predicted 1275
9 SASI_Mm01_00233690 predicted 258
10 SASI_Mm01_00233691 predicted 1702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264438 predicted 1918
2 SASI_Mm01_00264439 predicted 375
3 SASI_Mm01_00264440 predicted 299
4 SASI_Mm01_00264441 predicted 677
5 SASI_Mm01_00264442 predicted 1050
6 SASI_Mm01_00264443 predicted 609
7 SASI_Mm01_00264444 predicted 1873
8 SASI_Mm01_00264445 predicted 2524
9 SASI_Mm01_00264446 predicted 580
10 SASI_Mm01_00264447 predicted 1940
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229869 predicted 1794
2 SASI_Mm01_00229870 predicted 383
3 SASI_Mm01_00229871 predicted 304
4 SASI_Mm01_00229872 predicted 564
5 SASI_Mm01_00229873 predicted 569
6 SASI_Mm01_00229874 predicted 931
7 SASI_Mm01_00229875 predicted 569
8 SASI_Mm01_00229876 predicted 1756
9 SASI_Mm01_00229877 predicted 2197
10 SASI_Mm01_00229878 predicted 2405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000124
ERCC6 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000124.2-3972s21c1
Sequence:CCGGATGGAGCCAGCCCAGATTATGCTCGAGCATAATCTGGGCTGGCTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000124.2-2710s21c1
Sequence:CCGGCAAGCAGGGTCAGCGAGTATTCTCGAGAATACTCGCTGACCCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000124.1-1748s1c1
Sequence:CCGGCGTGGTTCAAATTACAGGTTTCTCGAGAAACCTGTAATTTGAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000124.1-3002s1c1
Sequence:CCGGCGACAAATCTTCAAGCAGTTTCTCGAGAAACTGCTTGAAGATTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000124.1-2764s1c1
Sequence:CCGGGCCACTGATTACGAGATACAACTCGAGTTGTATCTCGTAATCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000124
ERCC6 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000124.2-3972s21c1
Sequence:CCGGATGGAGCCAGCCCAGATTATGCTCGAGCATAATCTGGGCTGGCTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000124.2-2710s21c1
Sequence:CCGGCAAGCAGGGTCAGCGAGTATTCTCGAGAATACTCGCTGACCCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000124.1-1748s1c1
Sequence:CCGGCGTGGTTCAAATTACAGGTTTCTCGAGAAACCTGTAATTTGAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000124.1-3002s1c1
Sequence:CCGGCGACAAATCTTCAAGCAGTTTCTCGAGAAACTGCTTGAAGATTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000124.1-2764s1c1
Sequence:CCGGGCCACTGATTACGAGATACAACTCGAGTTGTATCTCGTAATCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000124
ERCC6 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000124.2-3972s21c1
Sequence:CCGGATGGAGCCAGCCCAGATTATGCTCGAGCATAATCTGGGCTGGCTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000124.2-2710s21c1
Sequence:CCGGCAAGCAGGGTCAGCGAGTATTCTCGAGAATACTCGCTGACCCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000124.1-1748s1c1
Sequence:CCGGCGTGGTTCAAATTACAGGTTTCTCGAGAAACCTGTAATTTGAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000124.1-3002s1c1
Sequence:CCGGCGACAAATCTTCAAGCAGTTTCTCGAGAAACTGCTTGAAGATTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000124.1-2764s1c1
Sequence:CCGGGCCACTGATTACGAGATACAACTCGAGTTGTATCTCGTAATCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177043
ERCC6 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000173630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177043.2-547s1c1
Sequence:CCGGGCATCCTTCATCACTAACAGACTCGAGTCTGTTAGTGATGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177043.2-689s1c1
Sequence:CCGGCGAGCAAGAAACCACATGATTCTCGAGAATCATGTGGTTTCTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177043.2-805s1c1
Sequence:CCGGGAGGAACTTCATTGCTTTCCACTCGAGTGGAAAGCAATGAAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177043.2-256s1c1
Sequence:CCGGGAGCAGCGATGATTATGTGTTCTCGAGAACACATAATCATCGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177043
ERCC6 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000173630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177043.2-547s1c1
Sequence:CCGGGCATCCTTCATCACTAACAGACTCGAGTCTGTTAGTGATGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177043.2-689s1c1
Sequence:CCGGCGAGCAAGAAACCACATGATTCTCGAGAATCATGTGGTTTCTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177043.2-805s1c1
Sequence:CCGGGAGGAACTTCATTGCTTTCCACTCGAGTGGAAAGCAATGAAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177043.2-256s1c1
Sequence:CCGGGAGCAGCGATGATTATGTGTTCTCGAGAACACATAATCATCGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177043
ERCC6 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000173630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177043.2-547s1c1
Sequence:CCGGGCATCCTTCATCACTAACAGACTCGAGTCTGTTAGTGATGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177043.2-689s1c1
Sequence:CCGGCGAGCAAGAAACCACATGATTCTCGAGAATCATGTGGTTTCTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177043.2-805s1c1
Sequence:CCGGGAGGAACTTCATTGCTTTCCACTCGAGTGGAAAGCAATGAAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177043.2-256s1c1
Sequence:CCGGGAGCAGCGATGATTATGTGTTCTCGAGAACACATAATCATCGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks