EMAIL THIS PAGE TO A FRIEND

ERCC6L2

excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2

Synonyms: C9orf102 RAD26L SR278
UniProtKB ID: A4D997, Q8N663, Q8N9D0
Gene ID:
Mouse(76251) excision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Rat(361197) excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2
naked mole-rat(101716590) excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2
domestic guinea pig(100728605) excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2
domestic cat(101088625) excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2
cow(508357) excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013608 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013608 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013608 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_088578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_088578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_088578 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010895 Rosetta Predictions human pricing
XM_001058999 Rosetta Predictions rat pricing
XM_341480 Rosetta Predictions rat pricing
NM_001013608 Rosetta Predictions mouse pricing
NM_023507 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305873 predicted 1575
2 SASI_Hs01_00164316 predicted 1716
3 SASI_Hs01_00164317 predicted 2017
4 SASI_Hs01_00164318 predicted 1609
5 SASI_Hs01_00164319 predicted 1851
6 SASI_Hs02_00305874 predicted 1599
7 SASI_Hs01_00164321 predicted 1597
8 SASI_Hs01_00164323 predicted 746
9 SASI_Hs02_00305875 predicted 779
10 SASI_Hs01_00164325 predicted 1160
11 SASI_Hs01_00164320 predicted 933
12 SASI_Hs01_00164322 predicted 2026
13 SASI_Hs01_00164324 predicted 1632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291574 predicted 3042
2 SASI_Rn02_00291575 predicted 1971
3 SASI_Rn02_00291576 predicted 962
4 SASI_Rn02_00291577 predicted 1280
5 SASI_Rn02_00291578 predicted 2940
6 SASI_Rn02_00291579 predicted 4563
7 SASI_Rn02_00291580 predicted 824
8 SASI_Rn02_00291581 predicted 1456
9 SASI_Rn02_00291582 predicted 1225
10 SASI_Rn02_00291583 predicted 2835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392992 predicted 3048
2 SASI_Rn02_00392993 predicted 1971
3 SASI_Rn02_00392994 predicted 960
4 SASI_Rn02_00392995 predicted 1273
5 SASI_Rn02_00392996 predicted 2946
6 SASI_Rn02_00392997 predicted 4559
7 SASI_Rn02_00392998 predicted 827
8 SASI_Rn02_00392999 predicted 1450
9 SASI_Rn02_00393000 predicted 1227
10 SASI_Rn02_00393001 predicted 2830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287251 predicted 1306
2 SASI_Mm02_00287252 predicted 1936
3 SASI_Mm02_00287253 predicted 2027
4 SASI_Mm02_00287254 predicted 1889
5 SASI_Mm02_00287255 predicted 1850
6 SASI_Mm02_00287256 predicted 932
7 SASI_Mm02_00287257 predicted 748
8 SASI_Mm02_00287258 predicted 803
9 SASI_Mm02_00287259 predicted 1472
10 SASI_Mm02_00287260 predicted 1995
11 SASI_Mm01_00176446 predicted 1055
12 SASI_Mm01_00176447 predicted 855
13 SASI_Mm01_00176448 predicted 1139
14 SASI_Mm01_00176449 predicted 757
15 SASI_Mm01_00176450 predicted 1185
16 SASI_Mm01_00176451 predicted 1601
17 SASI_Mm01_00176452 predicted 768
18 SASI_Mm01_00176453 predicted 490
19 SASI_Mm01_00176454 predicted 561
20 SASI_Mm01_00176455 predicted 1792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327157 predicted 1286
2 SASI_Mm01_00131302 predicted 1919
3 SASI_Mm02_00327158 predicted 2010
4 SASI_Mm01_00131303 predicted 1878
5 SASI_Mm01_00131306 predicted 1832
6 SASI_Mm01_00131307 predicted 918
7 SASI_Mm01_00131308 predicted 732
8 SASI_Mm01_00131310 predicted 793
9 SASI_Mm01_00131311 predicted 1450
10 SASI_Mm02_00327159 predicted 1975
11 SASI_Mm01_00131304 predicted 985
12 SASI_Mm01_00131305 predicted 2012
13 SASI_Mm01_00131309 predicted 1915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013608
VALIDATED
ERCC6L2 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-1578s21c1
Sequence:CCGGAGGATATGTGATCGGGTATTTCTCGAGAAATACCCGATCACATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013608.2-848s1c1
Sequence:CCGGCAATGAGCTGCTTCGTTTAAACTCGAGTTTAAACGAAGCAGCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013608.2-2860s1c1
Sequence:CCGGGAATCCCTAAGAACCATATACCTCGAGGTATATGGTTCTTAGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-3220s21c1
Sequence:CCGGACCGTAGCTCTCAGGTTATTGCTCGAGCAATAACCTGAGAGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-4777s21c1
Sequence:CCGGACGTGCCATTAACCTAGATATCTCGAGATATCTAGGTTAATGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-848s21c1
Sequence:CCGGCAATGAGCTGCTTCGTTTAAACTCGAGTTTAAACGAAGCAGCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-509s21c1
Sequence:CCGGTAATAGGTACTTGCGAGATTACTCGAGTAATCTCGCAAGTACCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013608.1-851s1c1
Sequence:CCGGGTAAAGGAGTTTGCTGAACAACTCGAGTTGTTCAGCAAACTCCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013608.1-126s1c1
Sequence:CCGGCCACTACTTCCTTGAAATTTACTCGAGTAAATTTCAAGGAAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013608.1-499s1c1
Sequence:CCGGCCACTCAAATCAGAATGTGATCTCGAGATCACATTCTGATTTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013608.1-1052s1c1
Sequence:CCGGCCCTCAAATGATAGTACTTTACTCGAGTAAAGTACTATCATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013608.1-2168s1c1
Sequence:CCGGCCCATTCATTATCTGAAAGATCTCGAGATCTTTCAGATAATGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013608.1-1917s1c1
Sequence:CCGGGCATGTTATCATGGGTTCTTTCTCGAGAAAGAACCCATGATAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013608
VALIDATED
ERCC6L2 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-1578s21c1
Sequence:CCGGAGGATATGTGATCGGGTATTTCTCGAGAAATACCCGATCACATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013608.2-848s1c1
Sequence:CCGGCAATGAGCTGCTTCGTTTAAACTCGAGTTTAAACGAAGCAGCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013608.2-2860s1c1
Sequence:CCGGGAATCCCTAAGAACCATATACCTCGAGGTATATGGTTCTTAGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-3220s21c1
Sequence:CCGGACCGTAGCTCTCAGGTTATTGCTCGAGCAATAACCTGAGAGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-4777s21c1
Sequence:CCGGACGTGCCATTAACCTAGATATCTCGAGATATCTAGGTTAATGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-848s21c1
Sequence:CCGGCAATGAGCTGCTTCGTTTAAACTCGAGTTTAAACGAAGCAGCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-509s21c1
Sequence:CCGGTAATAGGTACTTGCGAGATTACTCGAGTAATCTCGCAAGTACCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013608.1-851s1c1
Sequence:CCGGGTAAAGGAGTTTGCTGAACAACTCGAGTTGTTCAGCAAACTCCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013608.1-126s1c1
Sequence:CCGGCCACTACTTCCTTGAAATTTACTCGAGTAAATTTCAAGGAAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013608.1-499s1c1
Sequence:CCGGCCACTCAAATCAGAATGTGATCTCGAGATCACATTCTGATTTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013608.1-1052s1c1
Sequence:CCGGCCCTCAAATGATAGTACTTTACTCGAGTAAAGTACTATCATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013608.1-2168s1c1
Sequence:CCGGCCCATTCATTATCTGAAAGATCTCGAGATCTTTCAGATAATGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013608.1-1917s1c1
Sequence:CCGGGCATGTTATCATGGGTTCTTTCTCGAGAAAGAACCCATGATAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013608
VALIDATED
ERCC6L2 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-1578s21c1
Sequence:CCGGAGGATATGTGATCGGGTATTTCTCGAGAAATACCCGATCACATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013608.2-848s1c1
Sequence:CCGGCAATGAGCTGCTTCGTTTAAACTCGAGTTTAAACGAAGCAGCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013608.2-2860s1c1
Sequence:CCGGGAATCCCTAAGAACCATATACCTCGAGGTATATGGTTCTTAGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-3220s21c1
Sequence:CCGGACCGTAGCTCTCAGGTTATTGCTCGAGCAATAACCTGAGAGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-4777s21c1
Sequence:CCGGACGTGCCATTAACCTAGATATCTCGAGATATCTAGGTTAATGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-848s21c1
Sequence:CCGGCAATGAGCTGCTTCGTTTAAACTCGAGTTTAAACGAAGCAGCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013608.2-509s21c1
Sequence:CCGGTAATAGGTACTTGCGAGATTACTCGAGTAATCTCGCAAGTACCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013608.1-851s1c1
Sequence:CCGGGTAAAGGAGTTTGCTGAACAACTCGAGTTGTTCAGCAAACTCCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013608.1-126s1c1
Sequence:CCGGCCACTACTTCCTTGAAATTTACTCGAGTAAATTTCAAGGAAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013608.1-499s1c1
Sequence:CCGGCCACTCAAATCAGAATGTGATCTCGAGATCACATTCTGATTTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013608.1-1052s1c1
Sequence:CCGGCCCTCAAATGATAGTACTTTACTCGAGTAAAGTACTATCATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013608.1-2168s1c1
Sequence:CCGGCCCATTCATTATCTGAAAGATCTCGAGATCTTTCAGATAATGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013608.1-1917s1c1
Sequence:CCGGGCATGTTATCATGGGTTCTTTCTCGAGAAAGAACCCATGATAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_088578
ERCC6L2 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-731s1c1
Sequence:CCGGCCGGTTTCTTTATGGACACTACTCGAGTAGTGTCCATAAAGAAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-2117s1c1
Sequence:CCGGCGGTGCCAATGTTGTTGTATTCTCGAGAATACAACAACATTGGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-1448s1c1
Sequence:CCGGGCGCACCAAGACTCTTATCAACTCGAGTTGATAAGAGTCTTGGTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-1530s1c1
Sequence:CCGGGCTGTCTATCAAACAGTGTTACTCGAGTAACACTGTTTGATAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-531s1c1
Sequence:CCGGCCTCTTAAACAGCTTCAAGAACTCGAGTTCTTGAAGCTGTTTAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_088578
ERCC6L2 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-731s1c1
Sequence:CCGGCCGGTTTCTTTATGGACACTACTCGAGTAGTGTCCATAAAGAAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-2117s1c1
Sequence:CCGGCGGTGCCAATGTTGTTGTATTCTCGAGAATACAACAACATTGGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-1448s1c1
Sequence:CCGGGCGCACCAAGACTCTTATCAACTCGAGTTGATAAGAGTCTTGGTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-1530s1c1
Sequence:CCGGGCTGTCTATCAAACAGTGTTACTCGAGTAACACTGTTTGATAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-531s1c1
Sequence:CCGGCCTCTTAAACAGCTTCAAGAACTCGAGTTCTTGAAGCTGTTTAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_088578
ERCC6L2 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-731s1c1
Sequence:CCGGCCGGTTTCTTTATGGACACTACTCGAGTAGTGTCCATAAAGAAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-2117s1c1
Sequence:CCGGCGGTGCCAATGTTGTTGTATTCTCGAGAATACAACAACATTGGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-1448s1c1
Sequence:CCGGGCGCACCAAGACTCTTATCAACTCGAGTTGATAAGAGTCTTGGTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-1530s1c1
Sequence:CCGGGCTGTCTATCAAACAGTGTTACTCGAGTAACACTGTTTGATAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088578.7-531s1c1
Sequence:CCGGCCTCTTAAACAGCTTCAAGAACTCGAGTTCTTGAAGCTGTTTAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks