EMAIL THIS PAGE TO A FRIEND

ERCC6L

excision repair cross-complementing rodent repair deficiency, complementation group 6-like

78 Gene Product Result for
Synonyms: PICH RAD26L
UniProtKB ID: Q2NKX8, Q8NCI1, Q96H93, Q9NXQ8
Gene ID:
Mouse(236930) excision repair cross-complementing rodent repair deficiency complementation group 6 like
Rat(317252) excision repair cross-complementing rodent repair deficiency complementation group 6 - like
Zebrafish(100005291) excision repair cross-complementing rodent repair deficiency, complementation group 6-like
chicken(422135) excision repair cross-complementing rodent repair deficiency, complementation group 6-like
cow(782916) excision repair cross-complementing rodent repair deficiency, complementation group 6-like
Horse(100052221) excision repair cross-complementing rodent repair deficiency, complementation group 6-like
domestic cat(101081121) excision repair cross-complementing rodent repair deficiency, complementation group 6-like
dog(491955) excision repair cross-complementing rodent repair deficiency, complementation group 6-like
domestic guinea pig(100722447) excision repair cross-complementing rodent repair deficiency, complementation group 6-like
naked mole-rat(101726415) excision repair cross-complementing rodent repair deficiency, complementation group 6-like
sheep(101108989) excision repair cross-complementing rodent repair deficiency, complementation group 6-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146235 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146235 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146235 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_372231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372231 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017669 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009954 Rosetta Predictions human pricing
NM_017669 Rosetta Predictions human pricing
XM_001070442 Rosetta Predictions rat pricing
NM_146235 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222363 predicted 771
2 SASI_Hs01_00222364 predicted 3920
3 SASI_Hs01_00222365 predicted 2969
4 SASI_Hs01_00222366 predicted 2614
5 SASI_Hs01_00222367 predicted 951
6 SASI_Hs01_00222368 predicted 933
7 SASI_Hs01_00222369 predicted 3012
8 SASI_Hs01_00222370 predicted 2773
9 SASI_Hs01_00222371 predicted 3877
10 SASI_Hs01_00222372 predicted 3445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026624 predicted 642
2 SASI_Hs02_00350392 predicted 2934
3 SASI_Hs01_00026626 predicted 2847
4 SASI_Hs02_00350393 predicted 2517
5 SASI_Hs01_00026628 predicted 827
6 SASI_Hs01_00026629 predicted 809
7 SASI_Hs01_00026630 predicted 2885
8 SASI_Hs01_00026632 predicted 3753
9 SASI_Hs01_00026633 predicted 3325
10 SASI_Hs02_00350394 predicted 2571
11 SASI_Hs01_00026625 predicted 3795
12 SASI_Hs01_00026627 predicted 2493
13 SASI_Hs01_00026631 predicted 2648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070442 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331678 predicted 531
2 SASI_Rn02_00331679 predicted 1586
3 SASI_Rn02_00331680 predicted 2357
4 SASI_Rn02_00331681 predicted 2081
5 SASI_Rn02_00331682 predicted 3137
6 SASI_Rn02_00331683 predicted 2763
7 SASI_Rn02_00331684 predicted 2823
8 SASI_Rn02_00331685 predicted 3218
9 SASI_Rn02_00331686 predicted 704
10 SASI_Rn02_00331687 predicted 3679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079799 predicted 2779
2 SASI_Mm01_00079800 predicted 1792
3 SASI_Mm01_00079801 predicted 1580
4 SASI_Mm01_00079803 predicted 2799
5 SASI_Mm01_00079805 predicted 1205
6 SASI_Mm02_00341942 predicted 2856
7 SASI_Mm01_00079806 predicted 922
8 SASI_Mm02_00341943 predicted 528
9 SASI_Mm01_00079807 predicted 2377
10 SASI_Mm01_00079808 predicted 1457
11 SASI_Mm01_00079802 predicted 710
12 SASI_Mm01_00079804 predicted 2437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146235
VALIDATED
ERCC6L MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 6-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146235.2-2517s1c1
Sequence:CCGGGCTGAAAGTATAGGCGAAGTTCTCGAGAACTTCGCCTATACTTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146235.2-3897s1c1
Sequence:CCGGCTTTCAGAAGTGTTACCTAAACTCGAGTTTAGGTAACACTTCTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146235.2-114s1c1
Sequence:CCGGGCCGAGAGTTACCTGAGATATCTCGAGATATCTCAGGTAACTCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146235.2-391s1c1
Sequence:CCGGGCCTGTATAAGGATGGAAGAACTCGAGTTCTTCCATCCTTATACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146235.2-114s21c1
Sequence:CCGGGCCGAGAGTTACCTGAGATATCTCGAGATATCTCAGGTAACTCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146235.2-2517s21c1
Sequence:CCGGGCTGAAAGTATAGGCGAAGTTCTCGAGAACTTCGCCTATACTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146235.2-391s21c1
Sequence:CCGGGCCTGTATAAGGATGGAAGAACTCGAGTTCTTCCATCCTTATACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146235.2-3897s21c1
Sequence:CCGGCTTTCAGAAGTGTTACCTAAACTCGAGTTTAGGTAACACTTCTGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146235
VALIDATED
ERCC6L MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 6-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146235.2-2517s1c1
Sequence:CCGGGCTGAAAGTATAGGCGAAGTTCTCGAGAACTTCGCCTATACTTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146235.2-3897s1c1
Sequence:CCGGCTTTCAGAAGTGTTACCTAAACTCGAGTTTAGGTAACACTTCTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146235.2-114s1c1
Sequence:CCGGGCCGAGAGTTACCTGAGATATCTCGAGATATCTCAGGTAACTCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146235.2-391s1c1
Sequence:CCGGGCCTGTATAAGGATGGAAGAACTCGAGTTCTTCCATCCTTATACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146235.2-114s21c1
Sequence:CCGGGCCGAGAGTTACCTGAGATATCTCGAGATATCTCAGGTAACTCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146235.2-2517s21c1
Sequence:CCGGGCTGAAAGTATAGGCGAAGTTCTCGAGAACTTCGCCTATACTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146235.2-391s21c1
Sequence:CCGGGCCTGTATAAGGATGGAAGAACTCGAGTTCTTCCATCCTTATACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146235.2-3897s21c1
Sequence:CCGGCTTTCAGAAGTGTTACCTAAACTCGAGTTTAGGTAACACTTCTGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146235
VALIDATED
ERCC6L MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 6-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146235.2-2517s1c1
Sequence:CCGGGCTGAAAGTATAGGCGAAGTTCTCGAGAACTTCGCCTATACTTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146235.2-3897s1c1
Sequence:CCGGCTTTCAGAAGTGTTACCTAAACTCGAGTTTAGGTAACACTTCTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146235.2-114s1c1
Sequence:CCGGGCCGAGAGTTACCTGAGATATCTCGAGATATCTCAGGTAACTCTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146235.2-391s1c1
Sequence:CCGGGCCTGTATAAGGATGGAAGAACTCGAGTTCTTCCATCCTTATACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146235.2-114s21c1
Sequence:CCGGGCCGAGAGTTACCTGAGATATCTCGAGATATCTCAGGTAACTCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146235.2-2517s21c1
Sequence:CCGGGCTGAAAGTATAGGCGAAGTTCTCGAGAACTTCGCCTATACTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146235.2-391s21c1
Sequence:CCGGGCCTGTATAAGGATGGAAGAACTCGAGTTCTTCCATCCTTATACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146235.2-3897s21c1
Sequence:CCGGCTTTCAGAAGTGTTACCTAAACTCGAGTTTAGGTAACACTTCTGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372231
VALIDATED
ERCC6L MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 6-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_372231.2-2302s1c1
Sequence:CCGGCCTGGCTAAGAGAACCTGTATCTCGAGATACAGGTTCTCTTAGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_372231.2-1613s1c1
Sequence:CCGGGCACTTTAAGACATTGCGAATCTCGAGATTCGCAATGTCTTAAAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372231.2-3084s1c1
Sequence:CCGGGCAGGGTTTGTGCATAGCAAACTCGAGTTTGCTATGCACAAACCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372231.2-3483s1c1
Sequence:CCGGCCTGAAGATTATCCAGAAGAACTCGAGTTCTTCTGGATAATCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372231.2-168s1c1
Sequence:CCGGGCTGCTCATTACCTAAGATATCTCGAGATATCTTAGGTAATGAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372231
VALIDATED
ERCC6L MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 6-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_372231.2-2302s1c1
Sequence:CCGGCCTGGCTAAGAGAACCTGTATCTCGAGATACAGGTTCTCTTAGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_372231.2-1613s1c1
Sequence:CCGGGCACTTTAAGACATTGCGAATCTCGAGATTCGCAATGTCTTAAAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372231.2-3084s1c1
Sequence:CCGGGCAGGGTTTGTGCATAGCAAACTCGAGTTTGCTATGCACAAACCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372231.2-3483s1c1
Sequence:CCGGCCTGAAGATTATCCAGAAGAACTCGAGTTCTTCTGGATAATCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372231.2-168s1c1
Sequence:CCGGGCTGCTCATTACCTAAGATATCTCGAGATATCTTAGGTAATGAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372231
VALIDATED
ERCC6L MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 6-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_372231.2-2302s1c1
Sequence:CCGGCCTGGCTAAGAGAACCTGTATCTCGAGATACAGGTTCTCTTAGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_372231.2-1613s1c1
Sequence:CCGGGCACTTTAAGACATTGCGAATCTCGAGATTCGCAATGTCTTAAAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372231.2-3084s1c1
Sequence:CCGGGCAGGGTTTGTGCATAGCAAACTCGAGTTTGCTATGCACAAACCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372231.2-3483s1c1
Sequence:CCGGCCTGAAGATTATCCAGAAGAACTCGAGTTCTTCTGGATAATCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372231.2-168s1c1
Sequence:CCGGGCTGCTCATTACCTAAGATATCTCGAGATATCTTAGGTAATGAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017669
VALIDATED
ERCC6L MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 6-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017669.2-2455s21c1
Sequence:CCGGACAAGATCTCTCCAGTATAAACTCGAGTTTATACTGGAGAGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017669.2-4011s21c1
Sequence:CCGGTATTCTGAGCACTAGCTTAATCTCGAGATTAAGCTAGTGCTCAGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017669.2-2774s21c1
Sequence:CCGGTGCAATCCTTGGCCCATTATTCTCGAGAATAATGGGCCAAGGATTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017669.2-1708s21c1
Sequence:CCGGAGTAGGTGGTGTCGGTTTAACCTCGAGGTTAAACCGACACCACCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017669.2-547s21c1
Sequence:CCGGGATCATGCCAACCAATCTTATCTCGAGATAAGATTGGTTGGCATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017669
VALIDATED
ERCC6L MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 6-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017669.2-2455s21c1
Sequence:CCGGACAAGATCTCTCCAGTATAAACTCGAGTTTATACTGGAGAGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017669.2-4011s21c1
Sequence:CCGGTATTCTGAGCACTAGCTTAATCTCGAGATTAAGCTAGTGCTCAGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017669.2-2774s21c1
Sequence:CCGGTGCAATCCTTGGCCCATTATTCTCGAGAATAATGGGCCAAGGATTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017669.2-1708s21c1
Sequence:CCGGAGTAGGTGGTGTCGGTTTAACCTCGAGGTTAAACCGACACCACCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017669.2-547s21c1
Sequence:CCGGGATCATGCCAACCAATCTTATCTCGAGATAAGATTGGTTGGCATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017669
VALIDATED
ERCC6L MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 6-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017669.2-2455s21c1
Sequence:CCGGACAAGATCTCTCCAGTATAAACTCGAGTTTATACTGGAGAGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017669.2-4011s21c1
Sequence:CCGGTATTCTGAGCACTAGCTTAATCTCGAGATTAAGCTAGTGCTCAGAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017669.2-2774s21c1
Sequence:CCGGTGCAATCCTTGGCCCATTATTCTCGAGAATAATGGGCCAAGGATTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017669.2-1708s21c1
Sequence:CCGGAGTAGGTGGTGTCGGTTTAACCTCGAGGTTAAACCGACACCACCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017669.2-547s21c1
Sequence:CCGGGATCATGCCAACCAATCTTATCTCGAGATAAGATTGGTTGGCATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)