EMAIL THIS PAGE TO A FRIEND

ERCC8

excision repair cross-complementing rodent repair deficiency, complementation group 8

118 Gene Product Result for
Synonyms: CKN1 CSA UVSS2
UniProtKB ID: Q13216, B2RB64, Q6FHX5, Q96GB9
Gene ID:
Human(1161) Summary: This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. [provided by RefSeq, Jul 2008]
Mouse(71991) excision repaiross-complementing rodent repair deficiency, complementation group 8
Rat(310071) excision repair cross-complementing rodent repair deficiency, complementation group 8
Zebrafish(449811) excision repair cross-complementing rodent repair deficiency, complementation group 8
chicken(427153) excision repair cross-complementing rodent repair deficiency, complementation group 8
cow(518857) excision repair cross-complementing rodent repair deficiency, complementation group 8
Horse(100051199) excision repair cross-complementing rodent repair deficiency, complementation group 8
domestic cat(101099176) excision repair cross-complementing rodent repair deficiency, complementation group 8
dog(487225) excision repair cross-complementing rodent repair deficiency, complementation group 8
domestic guinea pig(100720574) excision repair cross-complementing rodent repair deficiency, complementation group 8
naked mole-rat(101724861) excision repair cross-complementing rodent repair deficiency, complementation group 8
sheep(101108254) excision repair cross-complementing rodent repair deficiency, complementation group 8
Domestic Rabbit(100352258) excision repair cross-complementing rodent repair deficiency, complementation group 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000082 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028042 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028042 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028042 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000082 Rosetta Predictions human pricing
NM_001007233 Rosetta Predictions human pricing
NM_001007234 Rosetta Predictions human pricing
NM_001107650 Rosetta Predictions rat pricing
NM_028042 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058239 predicted 1238
2 SASI_Hs01_00058240 predicted 724
3 SASI_Hs01_00058241 predicted 502
4 SASI_Hs02_00301829 predicted 193
5 SASI_Hs01_00058242 predicted 1068
6 SASI_Hs02_00301830 predicted 245
7 SASI_Hs01_00058244 predicted 851
8 SASI_Hs01_00058245 predicted 460
9 SASI_Hs01_00058246 predicted 876
10 SASI_Hs01_00058247 predicted 804
11 SASI_Hs01_00058243 predicted 1235
12 SASI_Hs01_00058248 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179370 predicted 1445
2 SASI_Hs01_00179371 predicted 931
3 SASI_Hs01_00179372 predicted 709
4 SASI_Hs01_00179373 predicted 1282
5 SASI_Hs01_00179374 predicted 1450
6 SASI_Hs01_00179375 predicted 1056
7 SASI_Hs01_00179376 predicted 667
8 SASI_Hs01_00179377 predicted 1092
9 SASI_Hs01_00179378 predicted 1011
10 SASI_Hs01_00179379 predicted 1533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121306 predicted 491
2 SASI_Hs01_00121307 predicted 679
3 SASI_Hs01_00121308 predicted 637
4 SASI_Hs01_00121309 predicted 674
5 SASI_Hs01_00121310 predicted 229
6 SASI_Hs01_00121311 predicted 293
7 SASI_Hs01_00121312 predicted 448
8 SASI_Hs01_00121313 predicted 432
9 SASI_Hs01_00121314 predicted 672
10 SASI_Hs01_00121315 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230915 predicted 1031
2 SASI_Rn02_00230916 predicted 406
3 SASI_Rn02_00230917 predicted 704
4 SASI_Rn02_00230918 predicted 539
5 SASI_Rn02_00230919 predicted 1073
6 SASI_Rn02_00230920 predicted 843
7 SASI_Rn02_00230921 predicted 1058
8 SASI_Rn02_00230922 predicted 1155
9 SASI_Rn02_00230923 predicted 737
10 SASI_Rn02_00230924 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135010 predicted 551
2 SASI_Mm01_00135011 predicted 1114
3 SASI_Mm02_00333216 predicted 203
4 SASI_Mm01_00135013 predicted 471
5 SASI_Mm01_00135014 predicted 564
6 SASI_Mm01_00135015 predicted 884
7 SASI_Mm01_00135016 predicted 367
8 SASI_Mm01_00135017 predicted 1072
9 SASI_Mm01_00135018 predicted 1145
10 SASI_Mm01_00135019 predicted 1166
11 SASI_Mm01_00135012 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027277
ERCC8 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 8
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000175788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027277.1-149s1c1
Sequence:CCGGGAGTTAAACAAAGACAGGGATCTCGAGATCCCTGTCTTTGTTTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027277.1-917s1c1
Sequence:CCGGGTGTGTAATGACAGCATGAAACTCGAGTTTCATGCTGTCATTACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027277
ERCC8 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 8
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000175788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027277.1-149s1c1
Sequence:CCGGGAGTTAAACAAAGACAGGGATCTCGAGATCCCTGTCTTTGTTTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027277.1-917s1c1
Sequence:CCGGGTGTGTAATGACAGCATGAAACTCGAGTTTCATGCTGTCATTACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027277
ERCC8 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 8
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000175788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027277.1-149s1c1
Sequence:CCGGGAGTTAAACAAAGACAGGGATCTCGAGATCCCTGTCTTTGTTTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027277.1-917s1c1
Sequence:CCGGGTGTGTAATGACAGCATGAAACTCGAGTTTCATGCTGTCATTACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000082
VALIDATED
ERCC8 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000082.x-1205s1c1
Sequence:CCGGGCAGCAGTGATGAAGAAGGATCTCGAGATCCTTCTTCATCACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000082.x-1869s1c1
Sequence:CCGGGCGCTAATGCTTGAACTCTTTCTCGAGAAAGAGTTCAAGCATTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000082.x-1149s1c1
Sequence:CCGGTGATGATGAGACTACAACAAACTCGAGTTTGTTGTAGTCTCATCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000082.x-168s1c1
Sequence:CCGGTGGAATTAACACCCTTGACATCTCGAGATGTCAAGGGTGTTAATTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000082.x-229s1c1
Sequence:CCGGGATGGTGTGATTGTACTTTATCTCGAGATAAAGTACAATCACACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000082.3-202s21c1
Sequence:CCGGTGGAATTAACACCCTTGACATCTCGAGATGTCAAGGGTGTTAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000082.3-263s21c1
Sequence:CCGGGATGGTGTGATTGTACTTTATCTCGAGATAAAGTACAATCACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000082.3-1903s21c1
Sequence:CCGGGCGCTAATGCTTGAACTCTTTCTCGAGAAAGAGTTCAAGCATTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000082.3-1183s21c1
Sequence:CCGGTGATGATGAGACTACAACAAACTCGAGTTTGTTGTAGTCTCATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000082.3-1239s21c1
Sequence:CCGGGCAGCAGTGATGAAGAAGGATCTCGAGATCCTTCTTCATCACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000082
VALIDATED
ERCC8 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000082.x-1205s1c1
Sequence:CCGGGCAGCAGTGATGAAGAAGGATCTCGAGATCCTTCTTCATCACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000082.x-1869s1c1
Sequence:CCGGGCGCTAATGCTTGAACTCTTTCTCGAGAAAGAGTTCAAGCATTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000082.x-1149s1c1
Sequence:CCGGTGATGATGAGACTACAACAAACTCGAGTTTGTTGTAGTCTCATCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000082.x-168s1c1
Sequence:CCGGTGGAATTAACACCCTTGACATCTCGAGATGTCAAGGGTGTTAATTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000082.x-229s1c1
Sequence:CCGGGATGGTGTGATTGTACTTTATCTCGAGATAAAGTACAATCACACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000082.3-202s21c1
Sequence:CCGGTGGAATTAACACCCTTGACATCTCGAGATGTCAAGGGTGTTAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000082.3-263s21c1
Sequence:CCGGGATGGTGTGATTGTACTTTATCTCGAGATAAAGTACAATCACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000082.3-1903s21c1
Sequence:CCGGGCGCTAATGCTTGAACTCTTTCTCGAGAAAGAGTTCAAGCATTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000082.3-1183s21c1
Sequence:CCGGTGATGATGAGACTACAACAAACTCGAGTTTGTTGTAGTCTCATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000082.3-1239s21c1
Sequence:CCGGGCAGCAGTGATGAAGAAGGATCTCGAGATCCTTCTTCATCACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000082
VALIDATED
ERCC8 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000082.x-1205s1c1
Sequence:CCGGGCAGCAGTGATGAAGAAGGATCTCGAGATCCTTCTTCATCACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000082.x-1869s1c1
Sequence:CCGGGCGCTAATGCTTGAACTCTTTCTCGAGAAAGAGTTCAAGCATTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000082.x-1149s1c1
Sequence:CCGGTGATGATGAGACTACAACAAACTCGAGTTTGTTGTAGTCTCATCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000082.x-168s1c1
Sequence:CCGGTGGAATTAACACCCTTGACATCTCGAGATGTCAAGGGTGTTAATTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000082.x-229s1c1
Sequence:CCGGGATGGTGTGATTGTACTTTATCTCGAGATAAAGTACAATCACACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000082.3-202s21c1
Sequence:CCGGTGGAATTAACACCCTTGACATCTCGAGATGTCAAGGGTGTTAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000082.3-263s21c1
Sequence:CCGGGATGGTGTGATTGTACTTTATCTCGAGATAAAGTACAATCACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000082.3-1903s21c1
Sequence:CCGGGCGCTAATGCTTGAACTCTTTCTCGAGAAAGAGTTCAAGCATTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000082.3-1183s21c1
Sequence:CCGGTGATGATGAGACTACAACAAACTCGAGTTTGTTGTAGTCTCATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000082.3-1239s21c1
Sequence:CCGGGCAGCAGTGATGAAGAAGGATCTCGAGATCCTTCTTCATCACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028042
VALIDATED
ERCC8 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 8
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028042.3-401s1c1
Sequence:CCGGCACATCCAGCTCATTTGATAACTCGAGTTATCAAATGAGCTGGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028042.3-1862s21c1
Sequence:CCGGTTGCAACAGTGGCATCATAATCTCGAGATTATGATGCCACTGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028042.3-190s21c1
Sequence:CCGGGGGTTAACACCCTCGACATTGCTCGAGCAATGTCGAGGGTGTTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028042.3-889s21c1
Sequence:CCGGACAACACCCTGGTGAACTATGCTCGAGCATAGTTCACCAGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028042.3-1073s21c1
Sequence:CCGGCTGTGTGTTCCAGCCTAATTTCTCGAGAAATTAGGCTGGAACACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028042.3-1037s21c1
Sequence:CCGGCGCCATGCTCAAGGGACATTACTCGAGTAATGTCCCTTGAGCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028042
VALIDATED
ERCC8 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 8
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028042.3-401s1c1
Sequence:CCGGCACATCCAGCTCATTTGATAACTCGAGTTATCAAATGAGCTGGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028042.3-1862s21c1
Sequence:CCGGTTGCAACAGTGGCATCATAATCTCGAGATTATGATGCCACTGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028042.3-190s21c1
Sequence:CCGGGGGTTAACACCCTCGACATTGCTCGAGCAATGTCGAGGGTGTTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028042.3-889s21c1
Sequence:CCGGACAACACCCTGGTGAACTATGCTCGAGCATAGTTCACCAGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028042.3-1073s21c1
Sequence:CCGGCTGTGTGTTCCAGCCTAATTTCTCGAGAAATTAGGCTGGAACACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028042.3-1037s21c1
Sequence:CCGGCGCCATGCTCAAGGGACATTACTCGAGTAATGTCCCTTGAGCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028042
VALIDATED
ERCC8 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 8
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028042.3-401s1c1
Sequence:CCGGCACATCCAGCTCATTTGATAACTCGAGTTATCAAATGAGCTGGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028042.3-1862s21c1
Sequence:CCGGTTGCAACAGTGGCATCATAATCTCGAGATTATGATGCCACTGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028042.3-190s21c1
Sequence:CCGGGGGTTAACACCCTCGACATTGCTCGAGCAATGTCGAGGGTGTTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028042.3-889s21c1
Sequence:CCGGACAACACCCTGGTGAACTATGCTCGAGCATAGTTCACCAGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028042.3-1073s21c1
Sequence:CCGGCTGTGTGTTCCAGCCTAATTTCTCGAGAAATTAGGCTGGAACACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028042.3-1037s21c1
Sequence:CCGGCGCCATGCTCAAGGGACATTACTCGAGTAATGTCCCTTGAGCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks