EMAIL THIS PAGE TO A FRIEND

EREG

epiregulin

175 Gene Product Result for
Synonyms: ER
UniProtKB ID: O14944, B2RC66, Q6FH69
Gene ID:
Human(2069) Summary: Epiregulin is a member of the epidermal growth factor family. Epiregulin can function as a ligand of EGFR (epidermal growth factor receptor), as well as a ligand of most members of the ERBB (v-erb-b2 oncogene homolog) family of tyrosine-kinase receptors. [provided by RefSeq, Jul 2008]
Mouse(13874) epiregulin
Rat(59325) epiregulin
sheep(101103724) epiregulin
chicken(408036) epiregulin
dog(611946) epiregulin
cow(100295476) epiregulin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001432 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001432 Rosetta Predictions human pricing
NM_021689 Rosetta Predictions rat pricing
NM_007950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069734 predicted 447
2 SASI_Hs02_00331836 predicted 351
3 SASI_Hs01_00069738 predicted 435
4 SASI_Hs01_00069739 predicted 290
5 SASI_Hs01_00069741 predicted 1042
6 SASI_Hs02_00331837 predicted 249
7 SASI_Hs02_00331838 predicted 581
8 SASI_Hs02_00331839 predicted 1151
9 SASI_Hs02_00331840 predicted 1092
10 SASI_Hs01_00069743 predicted 241
11 SASI_Hs01_00069735 predicted 352
12 SASI_Hs01_00069736 predicted 473
13 SASI_Hs01_00069737 predicted 492
14 SASI_Hs01_00069740 predicted 1097
15 SASI_Hs01_00069742 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099369 predicted 465
2 SASI_Rn01_00099370 predicted 300
3 SASI_Rn02_00262718 predicted 231
4 SASI_Rn01_00099371 predicted 331
5 SASI_Rn01_00099372 predicted 258
6 SASI_Rn01_00099373 predicted 380
7 SASI_Rn01_00099374 predicted 217
8 SASI_Rn01_00099377 predicted 511
9 SASI_Rn01_00099378 predicted 347
10 SASI_Rn02_00262719 predicted 340
11 SASI_Rn01_00099375 predicted 322
12 SASI_Rn01_00099376 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072956 predicted 296
2 SASI_Mm01_00072957 predicted 323
3 SASI_Mm01_00072958 predicted 248
4 SASI_Mm01_00072959 predicted 980
5 SASI_Mm01_00072961 predicted 1126
6 SASI_Mm02_00312817 predicted 228
7 SASI_Mm02_00312818 predicted 850
8 SASI_Mm01_00072962 predicted 234
9 SASI_Mm01_00072963 predicted 888
10 SASI_Mm01_00072964 predicted 949
11 SASI_Mm01_00072960 predicted 851
12 SASI_Mm01_00072965 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007950
VALIDATED
EREG MISSION shRNA Bacterial Glycerol Stock
epiregulin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007950.2-424s21c1
Sequence:CCGGTGCGATGTGAGCACTTCTTTCCTCGAGGAAAGAAGTGCTCACATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007950.2-1063s21c1
Sequence:CCGGGTTGGCGAGCCTCGTAGTATACTCGAGTATACTACGAGGCTCGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007950.2-515s21c1
Sequence:CCGGCATAACCGCTGGATGCATATACTCGAGTATATGCATCCAGCGGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007950.2-298s21c1
Sequence:CCGGGTGTGGCTCAAGTGCAGATTACTCGAGTAATCTGCACTTGAGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007950.2-481s21c1
Sequence:CCGGCGTTGACAGTGATTCTCATTTCTCGAGAAATGAGAATCACTGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007950.1-524s1c1
Sequence:CCGGGCATATACTATTTCTGCAGATCTCGAGATCTGCAGAAATAGTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007950.1-382s1c1
Sequence:CCGGGAGAAATTCTGCAGATGTGAACTCGAGTTCACATCTGCAGAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007950.1-450s1c1
Sequence:CCGGCCAACCCTTGAGCAAAGAATACTCGAGTATTCTTTGCTCAAGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007950
VALIDATED
EREG MISSION shRNA shRNA Plasmid DNA
epiregulin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007950.2-424s21c1
Sequence:CCGGTGCGATGTGAGCACTTCTTTCCTCGAGGAAAGAAGTGCTCACATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007950.2-1063s21c1
Sequence:CCGGGTTGGCGAGCCTCGTAGTATACTCGAGTATACTACGAGGCTCGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007950.2-515s21c1
Sequence:CCGGCATAACCGCTGGATGCATATACTCGAGTATATGCATCCAGCGGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007950.2-298s21c1
Sequence:CCGGGTGTGGCTCAAGTGCAGATTACTCGAGTAATCTGCACTTGAGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007950.2-481s21c1
Sequence:CCGGCGTTGACAGTGATTCTCATTTCTCGAGAAATGAGAATCACTGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007950.1-524s1c1
Sequence:CCGGGCATATACTATTTCTGCAGATCTCGAGATCTGCAGAAATAGTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007950.1-382s1c1
Sequence:CCGGGAGAAATTCTGCAGATGTGAACTCGAGTTCACATCTGCAGAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007950.1-450s1c1
Sequence:CCGGCCAACCCTTGAGCAAAGAATACTCGAGTATTCTTTGCTCAAGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007950
VALIDATED
EREG MISSION shRNA Lentiviral Transduction Particles
epiregulin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007950.2-424s21c1
Sequence:CCGGTGCGATGTGAGCACTTCTTTCCTCGAGGAAAGAAGTGCTCACATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007950.2-1063s21c1
Sequence:CCGGGTTGGCGAGCCTCGTAGTATACTCGAGTATACTACGAGGCTCGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007950.2-515s21c1
Sequence:CCGGCATAACCGCTGGATGCATATACTCGAGTATATGCATCCAGCGGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007950.2-298s21c1
Sequence:CCGGGTGTGGCTCAAGTGCAGATTACTCGAGTAATCTGCACTTGAGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007950.2-481s21c1
Sequence:CCGGCGTTGACAGTGATTCTCATTTCTCGAGAAATGAGAATCACTGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007950.1-524s1c1
Sequence:CCGGGCATATACTATTTCTGCAGATCTCGAGATCTGCAGAAATAGTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007950.1-382s1c1
Sequence:CCGGGAGAAATTCTGCAGATGTGAACTCGAGTTCACATCTGCAGAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007950.1-450s1c1
Sequence:CCGGCCAACCCTTGAGCAAAGAATACTCGAGTATTCTTTGCTCAAGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001432
EREG MISSION shRNA Bacterial Glycerol Stock
epiregulin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001432.x-703s1c1
Sequence:CCGGATAACAGTGTGCCTGGTTAACTCGAGTTAACCAGGCACACTGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001432.x-3889s1c1
Sequence:CCGGAATTGGTATACTGGTATGACCTCGAGGTCATACCAGTATACCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001432.1-3682s1c1
Sequence:CCGGGCCACATAATAACCCAGTTAACTCGAGTTAACTGGGTTATTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001432.1-499s1c1
Sequence:CCGGCCAACCTTTAAGCAAAGAGTACTCGAGTACTCTTTGCTTAAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001432.1-565s1c1
Sequence:CCGGCGTCGGTTCCACATATTATTTCTCGAGAAATAATATGTGGAACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001432
EREG MISSION shRNA shRNA Plasmid DNA
epiregulin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001432.x-703s1c1
Sequence:CCGGATAACAGTGTGCCTGGTTAACTCGAGTTAACCAGGCACACTGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001432.x-3889s1c1
Sequence:CCGGAATTGGTATACTGGTATGACCTCGAGGTCATACCAGTATACCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001432.1-3682s1c1
Sequence:CCGGGCCACATAATAACCCAGTTAACTCGAGTTAACTGGGTTATTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001432.1-499s1c1
Sequence:CCGGCCAACCTTTAAGCAAAGAGTACTCGAGTACTCTTTGCTTAAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001432.1-565s1c1
Sequence:CCGGCGTCGGTTCCACATATTATTTCTCGAGAAATAATATGTGGAACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001432
EREG MISSION shRNA Lentiviral Transduction Particles
epiregulin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001432.x-703s1c1
Sequence:CCGGATAACAGTGTGCCTGGTTAACTCGAGTTAACCAGGCACACTGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001432.x-3889s1c1
Sequence:CCGGAATTGGTATACTGGTATGACCTCGAGGTCATACCAGTATACCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001432.1-3682s1c1
Sequence:CCGGGCCACATAATAACCCAGTTAACTCGAGTTAACTGGGTTATTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001432.1-499s1c1
Sequence:CCGGCCAACCTTTAAGCAAAGAGTACTCGAGTACTCTTTGCTTAAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001432.1-565s1c1
Sequence:CCGGCGTCGGTTCCACATATTATTTCTCGAGAAATAATATGTGGAACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks