EMAIL THIS PAGE TO A FRIEND

ERF

Ets2 repressor factor

66 Gene Product Result for
Synonyms: CRS4 PE-2 PE2
UniProtKB ID: P50548, B2RAP1, Q59G38, Q9UPI7
Gene ID:
Human(2077) Summary: Members of the ETS family of transcription factors, such as ERF, regulate cell proliferation and differentiation. They share a highly conserved DNA-binding domain, the ETS domain, that recognizes the sequence GGAA/T (de Castro et al., 1997 [PubMed 9192842]
Mouse(13875) Ets2 repressor factor
Rat(292721) Ets2 repressor factor
Zebrafish(560416) Ets2 repressor factor
dog(100687937) eukaryotic translation termination factor 1
cow(789798) Ets2 repressor factor
domestic cat(101085420) Ets2 repressor factor
domestic guinea pig(101787764) Ets2 repressor factor
naked mole-rat(101715605) Ets2 repressor factor
sheep(101102508) Ets2 repressor factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101089 Anti-ERF (136-150) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1101090 Anti-ERF (316-330) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
AV31651 Anti-ERF antibody produced in rabbit affinity isolated antibody mouse, horse, yeast, canine, zebrafish, rat, human, pig, bovine
western blot pricing
SAB2103246 Anti-ERF antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA067952 Anti-ERF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA058532 Anti-ERF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2105141 Anti-ERF, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, horse, human, mouse, rabbit, rat
western blot pricing
SAB4500806 Anti-ERF, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4500807 Anti-ERF, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
SAB4503911 Anti-phospho-ERF (pThr526) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing
WH0002077M1 Monoclonal Anti-ERF antibody produced in mouse clone 1E5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403790 Monoclonal Anti-ERF antibody produced in mouse clone 3F11, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010155 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010155 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010155 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006494 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006494 Rosetta Predictions human pricing
XM_001077208 Rosetta Predictions rat pricing
XM_218336 Rosetta Predictions rat pricing
NM_010155 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095844 predicted 1077
2 SASI_Hs01_00095845 predicted 838
3 SASI_Hs01_00095846 predicted 489
4 SASI_Hs01_00095847 predicted 495
5 SASI_Hs01_00095848 predicted 423
6 SASI_Hs01_00095850 predicted 701
7 SASI_Hs01_00095851 predicted 1604
8 SASI_Hs01_00095852 predicted 1605
9 SASI_Hs01_00095853 predicted 480
10 SASI_Hs02_00341694 predicted 721
11 SASI_Hs01_00095849 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356180 predicted 703
2 SASI_Rn02_00356181 predicted 257
3 SASI_Rn02_00356182 predicted 496
4 SASI_Rn02_00356183 predicted 485
5 SASI_Rn02_00356184 predicted 289
6 SASI_Rn02_00356185 predicted 489
7 SASI_Rn02_00356186 predicted 491
8 SASI_Rn02_00356187 predicted 646
9 SASI_Rn02_00356188 predicted 1278
10 SASI_Rn02_00356189 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377692 predicted 486
2 SASI_Rn02_00377693 predicted 1596
3 SASI_Rn02_00377694 predicted 255
4 SASI_Rn02_00377695 predicted 1433
5 SASI_Rn02_00377696 predicted 1064
6 SASI_Rn02_00377697 predicted 491
7 SASI_Rn02_00377698 predicted 1120
8 SASI_Rn02_00377699 predicted 1491
9 SASI_Rn02_00377700 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088126 predicted 539
2 SASI_Mm01_00088127 predicted 1240
3 SASI_Mm01_00088128 predicted 314
4 SASI_Mm01_00088129 predicted 461
5 SASI_Mm01_00088130 predicted 746
6 SASI_Mm01_00088131 predicted 984
7 SASI_Mm01_00088132 predicted 403
8 SASI_Mm01_00088133 predicted 959
9 SASI_Mm01_00088134 predicted 1241
10 SASI_Mm02_00317913 predicted 333
11 SASI_Mm01_00088135 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010155
VALIDATED
ERF MISSION shRNA Bacterial Glycerol Stock
Ets2 repressor factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010155.2-2792s1c1
Sequence:CCGGGCCTACTTTGAGATGTCACAACTCGAGTTGTGACATCTCAAAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010155.2-311s1c1
Sequence:CCGGCCGGGCTTTGCGCTATTATTACTCGAGTAATAATAGCGCAAAGCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010155.2-1389s1c1
Sequence:CCGGGTGACTGACATCAGTGACGAACTCGAGTTCGTCACTGATGTCAGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010155.2-322s1c1
Sequence:CCGGGCTATTATTACAACAAGCGCACTCGAGTGCGCTTGTTGTAATAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010155.2-550s1c1
Sequence:CCGGCACCGGCTTGTTCTTCATCATCTCGAGATGATGAAGAACAAGCCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010155.3-2887s21c1
Sequence:CCGGGCCTACTTTGAGATGTCACAACTCGAGTTGTGACATCTCAAAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010155.3-404s21c1
Sequence:CCGGCCGGGCTTTGCGCTATTATTACTCGAGTAATAATAGCGCAAAGCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010155.3-643s21c1
Sequence:CCGGCACCGGCTTGTTCTTCATCATCTCGAGATGATGAAGAACAAGCCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010155.3-1482s21c1
Sequence:CCGGGTGACTGACATCAGTGACGAACTCGAGTTCGTCACTGATGTCAGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010155
VALIDATED
ERF MISSION shRNA shRNA Plasmid DNA
Ets2 repressor factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010155.2-2792s1c1
Sequence:CCGGGCCTACTTTGAGATGTCACAACTCGAGTTGTGACATCTCAAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010155.2-311s1c1
Sequence:CCGGCCGGGCTTTGCGCTATTATTACTCGAGTAATAATAGCGCAAAGCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010155.2-1389s1c1
Sequence:CCGGGTGACTGACATCAGTGACGAACTCGAGTTCGTCACTGATGTCAGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010155.2-322s1c1
Sequence:CCGGGCTATTATTACAACAAGCGCACTCGAGTGCGCTTGTTGTAATAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010155.2-550s1c1
Sequence:CCGGCACCGGCTTGTTCTTCATCATCTCGAGATGATGAAGAACAAGCCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010155.3-2887s21c1
Sequence:CCGGGCCTACTTTGAGATGTCACAACTCGAGTTGTGACATCTCAAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010155.3-404s21c1
Sequence:CCGGCCGGGCTTTGCGCTATTATTACTCGAGTAATAATAGCGCAAAGCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010155.3-643s21c1
Sequence:CCGGCACCGGCTTGTTCTTCATCATCTCGAGATGATGAAGAACAAGCCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010155.3-1482s21c1
Sequence:CCGGGTGACTGACATCAGTGACGAACTCGAGTTCGTCACTGATGTCAGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010155
VALIDATED
ERF MISSION shRNA Lentiviral Transduction Particles
Ets2 repressor factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010155.2-2792s1c1
Sequence:CCGGGCCTACTTTGAGATGTCACAACTCGAGTTGTGACATCTCAAAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010155.2-311s1c1
Sequence:CCGGCCGGGCTTTGCGCTATTATTACTCGAGTAATAATAGCGCAAAGCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010155.2-1389s1c1
Sequence:CCGGGTGACTGACATCAGTGACGAACTCGAGTTCGTCACTGATGTCAGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010155.2-322s1c1
Sequence:CCGGGCTATTATTACAACAAGCGCACTCGAGTGCGCTTGTTGTAATAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010155.2-550s1c1
Sequence:CCGGCACCGGCTTGTTCTTCATCATCTCGAGATGATGAAGAACAAGCCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010155.3-2887s21c1
Sequence:CCGGGCCTACTTTGAGATGTCACAACTCGAGTTGTGACATCTCAAAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010155.3-404s21c1
Sequence:CCGGCCGGGCTTTGCGCTATTATTACTCGAGTAATAATAGCGCAAAGCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010155.3-643s21c1
Sequence:CCGGCACCGGCTTGTTCTTCATCATCTCGAGATGATGAAGAACAAGCCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010155.3-1482s21c1
Sequence:CCGGGTGACTGACATCAGTGACGAACTCGAGTTCGTCACTGATGTCAGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006494
VALIDATED
ERF MISSION shRNA Bacterial Glycerol Stock
Ets2 repressor factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006494.1-1974s1c1
Sequence:CCGGCCTGTCTCTGTGGGTTTCTAACTCGAGTTAGAAACCCACAGAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006494.1-459s1c1
Sequence:CCGGCTGGTCAATTACCCATTCATTCTCGAGAATGAATGGGTAATTGACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006494.1-1437s1c1
Sequence:CCGGGAGGTGACTGACATCAGTGATCTCGAGATCACTGATGTCAGTCACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006494.1-807s1c1
Sequence:CCGGCCTGGTGTCTTCCGAGTCTATCTCGAGATAGACTCGGAAGACACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006494.1-374s1c1
Sequence:CCGGCCTGCGCTATTACTATAACAACTCGAGTTGTTATAGTAATAGCGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006494.2-843s21c1
Sequence:CCGGCCTGGTGTCTTCCGAGTCTATCTCGAGATAGACTCGGAAGACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006494.2-1106s21c1
Sequence:CCGGCCACACCCAAAGCGTCTACAACTCGAGTTGTAGACGCTTTGGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006494.2-2107s21c1
Sequence:CCGGGAATTGAGGCTTTGGCCTTAACTCGAGTTAAGGCCAAAGCCTCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006494.2-1072s21c1
Sequence:CCGGTCAGCCCTGAGGACATGAAACCTCGAGGTTTCATGTCCTCAGGGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006494.2-1473s21c1
Sequence:CCGGGAGGTGACTGACATCAGTGATCTCGAGATCACTGATGTCAGTCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006494
VALIDATED
ERF MISSION shRNA shRNA Plasmid DNA
Ets2 repressor factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006494.1-1974s1c1
Sequence:CCGGCCTGTCTCTGTGGGTTTCTAACTCGAGTTAGAAACCCACAGAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006494.1-459s1c1
Sequence:CCGGCTGGTCAATTACCCATTCATTCTCGAGAATGAATGGGTAATTGACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006494.1-1437s1c1
Sequence:CCGGGAGGTGACTGACATCAGTGATCTCGAGATCACTGATGTCAGTCACCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006494.1-807s1c1
Sequence:CCGGCCTGGTGTCTTCCGAGTCTATCTCGAGATAGACTCGGAAGACACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006494.1-374s1c1
Sequence:CCGGCCTGCGCTATTACTATAACAACTCGAGTTGTTATAGTAATAGCGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006494.2-843s21c1
Sequence:CCGGCCTGGTGTCTTCCGAGTCTATCTCGAGATAGACTCGGAAGACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006494.2-1106s21c1
Sequence:CCGGCCACACCCAAAGCGTCTACAACTCGAGTTGTAGACGCTTTGGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006494.2-2107s21c1
Sequence:CCGGGAATTGAGGCTTTGGCCTTAACTCGAGTTAAGGCCAAAGCCTCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006494.2-1072s21c1
Sequence:CCGGTCAGCCCTGAGGACATGAAACCTCGAGGTTTCATGTCCTCAGGGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006494.2-1473s21c1
Sequence:CCGGGAGGTGACTGACATCAGTGATCTCGAGATCACTGATGTCAGTCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006494
VALIDATED
ERF MISSION shRNA Lentiviral Transduction Particles
Ets2 repressor factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006494.1-1974s1c1
Sequence:CCGGCCTGTCTCTGTGGGTTTCTAACTCGAGTTAGAAACCCACAGAGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006494.1-459s1c1
Sequence:CCGGCTGGTCAATTACCCATTCATTCTCGAGAATGAATGGGTAATTGACCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006494.1-1437s1c1
Sequence:CCGGGAGGTGACTGACATCAGTGATCTCGAGATCACTGATGTCAGTCACCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006494.1-807s1c1
Sequence:CCGGCCTGGTGTCTTCCGAGTCTATCTCGAGATAGACTCGGAAGACACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006494.1-374s1c1
Sequence:CCGGCCTGCGCTATTACTATAACAACTCGAGTTGTTATAGTAATAGCGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006494.2-843s21c1
Sequence:CCGGCCTGGTGTCTTCCGAGTCTATCTCGAGATAGACTCGGAAGACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006494.2-1106s21c1
Sequence:CCGGCCACACCCAAAGCGTCTACAACTCGAGTTGTAGACGCTTTGGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006494.2-2107s21c1
Sequence:CCGGGAATTGAGGCTTTGGCCTTAACTCGAGTTAAGGCCAAAGCCTCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006494.2-1072s21c1
Sequence:CCGGTCAGCCCTGAGGACATGAAACCTCGAGGTTTCATGTCCTCAGGGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006494.2-1473s21c1
Sequence:CCGGGAGGTGACTGACATCAGTGATCTCGAGATCACTGATGTCAGTCACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)