EMAIL THIS PAGE TO A FRIEND

ERG

v-ets avian erythroblastosis virus E26 oncogene homolog

Synonyms: erg-3 p55
Gene ID:
Human(2078) Summary: This gene encodes a member of the erythroblast transformation-specific (ETS) family of transcriptions factors. All members of this family are key regulators of embryonic development, cell proliferation, differentiation, angiogenesis, inflammation, and apoptosis. The protein encoded by this gene is mainly expressed in the nucleus. It contains an ETS DNA-binding domain and a PNT (pointed) domain which is implicated in the self-association of chimeric oncoproteins. This protein is required for platelet adhesion to the subendothelium, inducing vascular cell remodeling. It also regulates hematopoesis, and the differentiation and maturation of megakaryocytic cells. This gene is involved in chromosomal translocations, resulting in different fusion gene products, such as TMPSSR2-ERG and NDRG1-ERG in prostate cancer, EWS-ERG in Ewing's sarcoma and FUS-ERG in acute myeloid leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2012]
Mouse(13876) avian erythroblastosis virus E-26 (v-ets) oncogene related
Rat(170909) v-ets avian erythroblastosis virus E26 oncogene
Zebrafish(494073) v-ets erythroblastosis virus E26 oncogene like (avian)
chicken(374146) v-ets erythroblastosis virus E26 oncogene homolog
dog(487760) v-ets erythroblastosis virus E26 oncogene homolog (avian)
domestic cat(101099895) v-ets erythroblastosis virus E26 oncogene homolog (avian)
Horse(100051563) v-ets erythroblastosis virus E26 oncogene homolog (avian)
cow(535231) v-ets erythroblastosis virus E26 oncogene homolog (avian)
sheep(101110646) v-ets erythroblastosis virus E26 oncogene homolog (avian)
Domestic Rabbit(100347277) v-ets erythroblastosis virus E26 oncogene homolog (avian)
naked mole-rat(101717041) v-ets erythroblastosis virus E26 oncogene homolog (avian)
domestic guinea pig(100713723) v-ets erythroblastosis virus E26 oncogene homolog (avian)
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E3158 Anti-ERG (171-185) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
E3283 Anti-ERG (256-270) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500363 Anti-ERG antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1408983 Anti-ERG antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2701682 Anti-erg antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
AV100625 Anti-ERG antibody produced in rabbit IgG fraction of antiserum canine, rat, mouse, rabbit, human, bovine, guinea pig, horse
western blot pricing
HPA046598 Anti-ERG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4300699 Anti-ERG antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB2107313 Anti-ERG antibody produced in rabbit affinity isolated antibody human, guinea pig, horse, mouse
ELISA, western blot pricing
SAB2103294 Anti-ERG, (N-terminal) antibody produced in rabbit affinity isolated antibody zebrafish, rat, guinea pig, rabbit, mouse, horse, human, bovine,
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004449 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004449 Rosetta Predictions human pricing
NM_182918 Rosetta Predictions human pricing
NM_133397 Rosetta Predictions rat pricing
NM_133659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151442 predicted 1826
2 SASI_Hs01_00151443 predicted 1551
3 SASI_Hs01_00151445 predicted 585
4 SASI_Hs01_00151446 predicted 1712
5 SASI_Hs01_00151447 predicted 1824
6 SASI_Hs02_00337630 predicted 572
7 SASI_Hs01_00151448 predicted 1830
8 SASI_Hs01_00151449 predicted 1293
9 SASI_Hs01_00151450 predicted 1341
10 SASI_Hs01_00151451 predicted 1623
11 SASI_Hs01_00151444 predicted 1867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107350 predicted 1782
2 SASI_Hs01_00107351 predicted 1505
3 SASI_Hs01_00107353 predicted 480
4 SASI_Hs01_00107354 predicted 1666
5 SASI_Hs01_00107355 predicted 1784
6 SASI_Hs02_00371034 predicted 456
7 SASI_Hs01_00107356 predicted 1795
8 SASI_Hs01_00107357 predicted 1248
9 SASI_Hs01_00107358 predicted 1301
10 SASI_Hs01_00107359 predicted 1586
11 SASI_Hs01_00107352 predicted 1827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031576 predicted 598
2 SASI_Rn01_00031577 predicted 853
3 SASI_Rn02_00267655 predicted 1466
4 SASI_Rn01_00031578 predicted 525
5 SASI_Rn01_00031579 predicted 704
6 SASI_Rn01_00031580 predicted 1431
7 SASI_Rn01_00031581 predicted 1481
8 SASI_Rn02_00267656 predicted 726
9 SASI_Rn01_00031582 predicted 1236
10 SASI_Rn01_00031583 predicted 254
11 SASI_Rn01_00031584 predicted 885
12 SASI_Rn01_00031585 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143300 predicted 714
2 SASI_Mm01_00143301 predicted 785
3 SASI_Mm01_00143302 predicted 1034
4 SASI_Mm01_00143303 predicted 264
5 SASI_Mm01_00143304 predicted 813
6 SASI_Mm01_00143305 predicted 357
7 SASI_Mm01_00143306 predicted 1439
8 SASI_Mm01_00143307 predicted 1013
9 SASI_Mm01_00143308 predicted 725
10 SASI_Mm01_00143309 predicted 426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133659
ERG MISSION shRNA Bacterial Glycerol Stock
v-ets avian erythroblastosis virus E26 oncogene homolog
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133659.2-2011s21c1
Sequence:CCGGACACCATGTATGATGTCATTTCTCGAGAAATGACATCATACATGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133659.2-1822s21c1
Sequence:CCGGATACTGTACATGGACATATAACTCGAGTTATATGTCCATGTACAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133659.2-1323s21c1
Sequence:CCGGAGCGCTACGCCTACAAGTTTGCTCGAGCAAACTTGTAGGCGTAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-782s1c1
Sequence:CCGGCCGATGACGTTGATAAGGCTTCTCGAGAAGCCTTATCAACGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-880s1c1
Sequence:CCGGCCCGAAGCTACGCAAAGAATTCTCGAGAATTCTTTGCGTAGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-1410s1c1
Sequence:CCGGCCTGCCATACATGGGCTCCTACTCGAGTAGGAGCCCATGTATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-216s1c1
Sequence:CCGGGTCACTATTTGAGTGTGCCTACTCGAGTAGGCACACTCAAATAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-721s1c1
Sequence:CCGGGCCGACATTCTTCTCTCACATCTCGAGATGTGAGAGAAGAATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133659
ERG MISSION shRNA shRNA Plasmid DNA
v-ets avian erythroblastosis virus E26 oncogene homolog
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133659.2-2011s21c1
Sequence:CCGGACACCATGTATGATGTCATTTCTCGAGAAATGACATCATACATGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133659.2-1822s21c1
Sequence:CCGGATACTGTACATGGACATATAACTCGAGTTATATGTCCATGTACAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133659.2-1323s21c1
Sequence:CCGGAGCGCTACGCCTACAAGTTTGCTCGAGCAAACTTGTAGGCGTAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-782s1c1
Sequence:CCGGCCGATGACGTTGATAAGGCTTCTCGAGAAGCCTTATCAACGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-880s1c1
Sequence:CCGGCCCGAAGCTACGCAAAGAATTCTCGAGAATTCTTTGCGTAGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-1410s1c1
Sequence:CCGGCCTGCCATACATGGGCTCCTACTCGAGTAGGAGCCCATGTATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-216s1c1
Sequence:CCGGGTCACTATTTGAGTGTGCCTACTCGAGTAGGCACACTCAAATAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-721s1c1
Sequence:CCGGGCCGACATTCTTCTCTCACATCTCGAGATGTGAGAGAAGAATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133659
ERG MISSION shRNA Lentiviral Transduction Particles
v-ets avian erythroblastosis virus E26 oncogene homolog
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133659.2-2011s21c1
Sequence:CCGGACACCATGTATGATGTCATTTCTCGAGAAATGACATCATACATGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133659.2-1822s21c1
Sequence:CCGGATACTGTACATGGACATATAACTCGAGTTATATGTCCATGTACAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133659.2-1323s21c1
Sequence:CCGGAGCGCTACGCCTACAAGTTTGCTCGAGCAAACTTGTAGGCGTAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-782s1c1
Sequence:CCGGCCGATGACGTTGATAAGGCTTCTCGAGAAGCCTTATCAACGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-880s1c1
Sequence:CCGGCCCGAAGCTACGCAAAGAATTCTCGAGAATTCTTTGCGTAGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-1410s1c1
Sequence:CCGGCCTGCCATACATGGGCTCCTACTCGAGTAGGAGCCCATGTATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-216s1c1
Sequence:CCGGGTCACTATTTGAGTGTGCCTACTCGAGTAGGCACACTCAAATAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133659.1-721s1c1
Sequence:CCGGGCCGACATTCTTCTCTCACATCTCGAGATGTGAGAGAAGAATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004449
ERG MISSION shRNA Bacterial Glycerol Stock
v-ets avian erythroblastosis virus E26 oncogene homolog
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-1642s21c1
Sequence:CCGGATCTGGGCACTTACTACTAAACTCGAGTTTAGTAGTAAGTGCCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-882s21c1
Sequence:CCGGGAGACTCCTCTTCCACATTTGCTCGAGCAAATGTGGAAGAGGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-1328s21c1
Sequence:CCGGCCGTTACTACTATGACAAGAACTCGAGTTCTTGTCATAGTAGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-331s21c1
Sequence:CCGGGTGAGGACCAGTCGTTGTTTGCTCGAGCAAACAACGACTGGTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-1080s21c1
Sequence:CCGGCGTCCTCAGTTAGATCCTTATCTCGAGATAAGGATCTAACTGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004449.3-2067s1c1
Sequence:CCGGGCCCATCAACAGACGTTGATACTCGAGTATCAACGTCTGTTGATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004449.3-823s1c1
Sequence:CCGGGATGATGTTGATAAAGCCTTACTCGAGTAAGGCTTTATCAACATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004449.3-1404s1c1
Sequence:CCGGCCACCCACAGAAGATGAACTTCTCGAGAAGTTCATCTTCTGTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004449.3-214s1c1
Sequence:CCGGGCTCATATCAAGGAAGCCTTACTCGAGTAAGGCTTCCTTGATATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004449.3-643s1c1
Sequence:CCGGGCGGTGAAAGAATATGGCCTTCTCGAGAAGGCCATATTCTTTCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004449
ERG MISSION shRNA shRNA Plasmid DNA
v-ets avian erythroblastosis virus E26 oncogene homolog
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-1642s21c1
Sequence:CCGGATCTGGGCACTTACTACTAAACTCGAGTTTAGTAGTAAGTGCCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-882s21c1
Sequence:CCGGGAGACTCCTCTTCCACATTTGCTCGAGCAAATGTGGAAGAGGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-1328s21c1
Sequence:CCGGCCGTTACTACTATGACAAGAACTCGAGTTCTTGTCATAGTAGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-331s21c1
Sequence:CCGGGTGAGGACCAGTCGTTGTTTGCTCGAGCAAACAACGACTGGTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-1080s21c1
Sequence:CCGGCGTCCTCAGTTAGATCCTTATCTCGAGATAAGGATCTAACTGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004449.3-2067s1c1
Sequence:CCGGGCCCATCAACAGACGTTGATACTCGAGTATCAACGTCTGTTGATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004449.3-823s1c1
Sequence:CCGGGATGATGTTGATAAAGCCTTACTCGAGTAAGGCTTTATCAACATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004449.3-1404s1c1
Sequence:CCGGCCACCCACAGAAGATGAACTTCTCGAGAAGTTCATCTTCTGTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004449.3-214s1c1
Sequence:CCGGGCTCATATCAAGGAAGCCTTACTCGAGTAAGGCTTCCTTGATATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004449.3-643s1c1
Sequence:CCGGGCGGTGAAAGAATATGGCCTTCTCGAGAAGGCCATATTCTTTCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004449
ERG MISSION shRNA Lentiviral Transduction Particles
v-ets avian erythroblastosis virus E26 oncogene homolog
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-1642s21c1
Sequence:CCGGATCTGGGCACTTACTACTAAACTCGAGTTTAGTAGTAAGTGCCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-882s21c1
Sequence:CCGGGAGACTCCTCTTCCACATTTGCTCGAGCAAATGTGGAAGAGGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-1328s21c1
Sequence:CCGGCCGTTACTACTATGACAAGAACTCGAGTTCTTGTCATAGTAGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-331s21c1
Sequence:CCGGGTGAGGACCAGTCGTTGTTTGCTCGAGCAAACAACGACTGGTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004449.4-1080s21c1
Sequence:CCGGCGTCCTCAGTTAGATCCTTATCTCGAGATAAGGATCTAACTGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004449.3-2067s1c1
Sequence:CCGGGCCCATCAACAGACGTTGATACTCGAGTATCAACGTCTGTTGATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004449.3-823s1c1
Sequence:CCGGGATGATGTTGATAAAGCCTTACTCGAGTAAGGCTTTATCAACATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004449.3-1404s1c1
Sequence:CCGGCCACCCACAGAAGATGAACTTCTCGAGAAGTTCATCTTCTGTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004449.3-214s1c1
Sequence:CCGGGCTCATATCAAGGAAGCCTTACTCGAGTAAGGCTTCCTTGATATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004449.3-643s1c1
Sequence:CCGGGCGGTGAAAGAATATGGCCTTCTCGAGAAGGCCATATTCTTTCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks