EMAIL THIS PAGE TO A FRIEND

ERGIC1

endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1

188 Gene Product Result for
Synonyms: ERGIC-32 ERGIC32 NET24
UniProtKB ID: Q969X5, Q9H0L0, Q9H2J2, Q9ULN9
Gene ID:
Human(57222) Summary: This gene encodes a cycling membrane protein which is an endoplasmic reticulum-golgi intermediate compartment (ERGIC) protein which interacts with other members of this protein family to increase their turnover. [provided by RefSeq, Jul 2008]
Mouse(67458) endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
Rat(287177) endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
Zebrafish(567774) endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
cow(616293) endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
domestic cat(101093164) endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
dog(609628) endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
chicken(416205) endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
domestic guinea pig(100718228) endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
naked mole-rat(101697164) endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
sheep(101107897) endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020462 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026170 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026170 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026170 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031711 Rosetta Predictions human pricing
NM_020462 Rosetta Predictions human pricing
XM_001066818 Rosetta Predictions rat pricing
NM_026170 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145079 predicted 1447
2 SASI_Hs01_00145080 predicted 665
3 SASI_Hs01_00145081 predicted 632
4 SASI_Hs01_00145082 predicted 322
5 SASI_Hs02_00307731 predicted 1394
6 SASI_Hs01_00145083 predicted 504
7 SASI_Hs01_00145084 predicted 439
8 SASI_Hs01_00145085 predicted 864
9 SASI_Hs01_00145086 predicted 386
10 SASI_Hs01_00145087 predicted 856
11 SASI_Hs01_00145088 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108766 predicted 464
2 SASI_Hs01_00108767 predicted 511
3 SASI_Hs01_00108768 predicted 656
4 SASI_Hs01_00108769 predicted 374
5 SASI_Hs01_00108770 predicted 396
6 SASI_Hs01_00108771 predicted 327
7 SASI_Hs01_00108772 predicted 320
8 SASI_Hs01_00108773 predicted 1545
9 SASI_Hs01_00108774 predicted 1505
10 SASI_Hs01_00108775 predicted 1515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066818 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318794 predicted 526
2 SASI_Rn02_00318795 predicted 501
3 SASI_Rn02_00318796 predicted 660
4 SASI_Rn02_00318797 predicted 457
5 SASI_Rn02_00318798 predicted 224
6 SASI_Rn02_00318799 predicted 351
7 SASI_Rn02_00318800 predicted 435
8 SASI_Rn02_00318801 predicted 492
9 SASI_Rn02_00318802 predicted 277
10 SASI_Rn02_00318803 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329807 predicted 1256
2 SASI_Mm02_00329808 predicted 403
3 SASI_Mm01_00052822 predicted 337
4 SASI_Mm02_00329809 predicted 538
5 SASI_Mm02_00329810 predicted 308
6 SASI_Mm01_00052824 predicted 1248
7 SASI_Mm01_00052825 predicted 232
8 SASI_Mm01_00052827 predicted 1240
9 SASI_Mm01_00052826 predicted 770
10 SASI_Mm01_00052830 predicted 1265
11 SASI_Mm01_00052823 predicted 1262
12 SASI_Mm01_00052828 predicted 541
13 SASI_Mm01_00052829 predicted 1036
14 SASI_Mm01_00052831 predicted 1251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020462
VALIDATED
ERGIC1 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020462.1-338s1c1
Sequence:CCGGGCTTGACATTCAGGATGAGATCTCGAGATCTCATCCTGAATGTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020462.1-297s1c1
Sequence:CCGGCTGAACATCAGTTTACCCAATCTCGAGATTGGGTAAACTGATGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020462.1-437s1c1
Sequence:CCGGGCAGTTCAGCATCAACAAGGTCTCGAGACCTTGTTGATGCTGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020462.1-602s1c1
Sequence:CCGGGTTCCTGCTGAGAATCTGGATCTCGAGATCCAGATTCTCAGCAGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020462.1-377s1c1
Sequence:CCGGCCACATCGACAACTCCATGAACTCGAGTTCATGGAGTTGTCGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020462
VALIDATED
ERGIC1 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020462.1-338s1c1
Sequence:CCGGGCTTGACATTCAGGATGAGATCTCGAGATCTCATCCTGAATGTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020462.1-297s1c1
Sequence:CCGGCTGAACATCAGTTTACCCAATCTCGAGATTGGGTAAACTGATGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020462.1-437s1c1
Sequence:CCGGGCAGTTCAGCATCAACAAGGTCTCGAGACCTTGTTGATGCTGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020462.1-602s1c1
Sequence:CCGGGTTCCTGCTGAGAATCTGGATCTCGAGATCCAGATTCTCAGCAGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020462.1-377s1c1
Sequence:CCGGCCACATCGACAACTCCATGAACTCGAGTTCATGGAGTTGTCGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020462
VALIDATED
ERGIC1 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020462.1-338s1c1
Sequence:CCGGGCTTGACATTCAGGATGAGATCTCGAGATCTCATCCTGAATGTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020462.1-297s1c1
Sequence:CCGGCTGAACATCAGTTTACCCAATCTCGAGATTGGGTAAACTGATGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020462.1-437s1c1
Sequence:CCGGGCAGTTCAGCATCAACAAGGTCTCGAGACCTTGTTGATGCTGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020462.1-602s1c1
Sequence:CCGGGTTCCTGCTGAGAATCTGGATCTCGAGATCCAGATTCTCAGCAGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020462.1-377s1c1
Sequence:CCGGCCACATCGACAACTCCATGAACTCGAGTTCATGGAGTTGTCGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026170
VALIDATED
ERGIC1 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026170.2-653s1c1
Sequence:CCGGCCATGACTACATCTTGAAGATCTCGAGATCTTCAAGATGTAGTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026170.2-164s1c1
Sequence:CCGGGACATATACTGGTGCCATTATCTCGAGATAATGGCACCAGTATATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026170.2-536s1c1
Sequence:CCGGCATGACACATACCATCCATAACTCGAGTTATGGATGGTATGTGTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-538s21c1
Sequence:CCGGTGACACATACCATCCATAAACCTCGAGGTTTATGGATGGTATGTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-320s21c1
Sequence:CCGGCAACATCAGTTTACCCAATTTCTCGAGAAATTGGGTAAACTGATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-412s21c1
Sequence:CCGGCCATGAAGATCCCGCTGAATACTCGAGTATTCAGCGGGATCTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-150s21c1
Sequence:CCGGGACCTCACACAGCCGACATATCTCGAGATATGTCGGCTGTGTGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-1582s21c1
Sequence:CCGGGAACGGTGGAGACTCGGATTTCTCGAGAAATCCGAGTCTCCACCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026170
VALIDATED
ERGIC1 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026170.2-653s1c1
Sequence:CCGGCCATGACTACATCTTGAAGATCTCGAGATCTTCAAGATGTAGTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026170.2-164s1c1
Sequence:CCGGGACATATACTGGTGCCATTATCTCGAGATAATGGCACCAGTATATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026170.2-536s1c1
Sequence:CCGGCATGACACATACCATCCATAACTCGAGTTATGGATGGTATGTGTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-538s21c1
Sequence:CCGGTGACACATACCATCCATAAACCTCGAGGTTTATGGATGGTATGTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-320s21c1
Sequence:CCGGCAACATCAGTTTACCCAATTTCTCGAGAAATTGGGTAAACTGATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-412s21c1
Sequence:CCGGCCATGAAGATCCCGCTGAATACTCGAGTATTCAGCGGGATCTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-150s21c1
Sequence:CCGGGACCTCACACAGCCGACATATCTCGAGATATGTCGGCTGTGTGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-1582s21c1
Sequence:CCGGGAACGGTGGAGACTCGGATTTCTCGAGAAATCCGAGTCTCCACCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026170
VALIDATED
ERGIC1 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026170.2-653s1c1
Sequence:CCGGCCATGACTACATCTTGAAGATCTCGAGATCTTCAAGATGTAGTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026170.2-164s1c1
Sequence:CCGGGACATATACTGGTGCCATTATCTCGAGATAATGGCACCAGTATATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026170.2-536s1c1
Sequence:CCGGCATGACACATACCATCCATAACTCGAGTTATGGATGGTATGTGTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-538s21c1
Sequence:CCGGTGACACATACCATCCATAAACCTCGAGGTTTATGGATGGTATGTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-320s21c1
Sequence:CCGGCAACATCAGTTTACCCAATTTCTCGAGAAATTGGGTAAACTGATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-412s21c1
Sequence:CCGGCCATGAAGATCCCGCTGAATACTCGAGTATTCAGCGGGATCTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-150s21c1
Sequence:CCGGGACCTCACACAGCCGACATATCTCGAGATATGTCGGCTGTGTGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026170.3-1582s21c1
Sequence:CCGGGAACGGTGGAGACTCGGATTTCTCGAGAAATCCGAGTCTCCACCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)