EMAIL THIS PAGE TO A FRIEND

ERGIC2

ERGIC and golgi 2

91 Gene Product Result for
Synonyms: Erv41 PTX1 cd002
UniProtKB ID: Q96RQ1, A6NHH6, Q53GY2, Q8N2Q9, Q9BVV9, Q9NZA3
Gene ID:
Human(51290) Summary: ERGIC2, or PTX1, is a ubiquitously expressed nuclear protein that is downregulated in prostate carcinoma (Kwok et al., 2001 [PubMed 11445006]
Mouse(67456) ERGIC and golgi 2
Rat(297728) ERGIC and golgi 2
sheep(101108735) ERGIC and golgi 2
naked mole-rat(101699961) ERGIC and golgi 2
domestic guinea pig(100726925) ERGIC and golgi 2
Zebrafish(393378) ERGIC and golgi 2
cow(512481) ERGIC and golgi 2
domestic cat(101086321) ERGIC and golgi 2
dog(477657) ERGIC and golgi 2
chicken(417697) ERGIC and golgi 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100704 Anti-ERGIC2 (ab1) antibody produced in rabbit affinity isolated antibody mouse, horse, bovine, canine, guinea pig, human, rat, rabbit
western blot pricing
SAB2100705 Anti-ERGIC2 (ab2) antibody produced in rabbit affinity isolated antibody canine, rabbit, zebrafish, rat, horse, mouse, guinea pig, bovine, human
western blot pricing
AV39265 Anti-ERGIC2 antibody produced in rabbit IgG fraction of antiserum horse, zebrafish, rat, guinea pig, human, rabbit, bovine, mouse, canine,
western blot pricing
HPA029222 Anti-ERGIC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA049695 Anti-ERGIC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016570 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016570 Rosetta Predictions human pricing
NM_001024984 Rosetta Predictions rat pricing
NM_026168 Rosetta Predictions mouse pricing
NM_026355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244130 predicted 544
2 SASI_Hs01_00244131 predicted 641
3 SASI_Hs01_00244132 predicted 512
4 SASI_Hs01_00244133 predicted 344
5 SASI_Hs01_00244135 predicted 243
6 SASI_Hs01_00244136 predicted 243
7 SASI_Hs01_00244137 predicted 250
8 SASI_Hs02_00349699 predicted 1021
9 SASI_Hs01_00244138 predicted 1084
10 SASI_Hs01_00244139 predicted 485
11 SASI_Hs01_00244134 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119722 predicted 644
2 SASI_Rn02_00202859 predicted 763
3 SASI_Rn01_00119724 predicted 515
4 SASI_Rn01_00119725 predicted 624
5 SASI_Rn01_00119726 predicted 206
6 SASI_Rn01_00119727 predicted 679
7 SASI_Rn01_00119728 predicted 794
8 SASI_Rn01_00119729 predicted 743
9 SASI_Rn01_00119730 predicted 784
10 SASI_Rn01_00119731 predicted 300
11 SASI_Rn01_00119723 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121441 predicted 323
2 SASI_Mm01_00121442 predicted 306
3 SASI_Mm01_00121443 predicted 331
4 SASI_Mm01_00121444 predicted 207
5 SASI_Mm01_00121446 predicted 400
6 SASI_Mm01_00121448 predicted 674
7 SASI_Mm01_00121449 predicted 266
8 SASI_Mm01_00121450 predicted 341
9 SASI_Mm02_00329804 predicted 612
10 SASI_Mm02_00329805 predicted 500
11 SASI_Mm01_00121445 predicted 390
12 SASI_Mm01_00121447 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155386 predicted 680
2 SASI_Mm01_00155387 predicted 660
3 SASI_Mm01_00155388 predicted 687
4 SASI_Mm01_00155389 predicted 557
5 SASI_Mm01_00155391 predicted 742
6 SASI_Mm01_00155393 predicted 1025
7 SASI_Mm01_00155394 predicted 616
8 SASI_Mm01_00155395 predicted 701
9 SASI_Mm02_00330073 predicted 964
10 SASI_Mm02_00330074 predicted 849
11 SASI_Mm01_00155390 predicted 736
12 SASI_Mm01_00155392 predicted 924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016570
VALIDATED
ERGIC2 MISSION shRNA Bacterial Glycerol Stock
ERGIC and golgi 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016570.2-801s21c1
Sequence:CCGGGAGAGCTTGTTCCAGCAATTACTCGAGTAATTGCTGGAACAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016570.2-443s21c1
Sequence:CCGGGCAGATGGTTTAGTTTATGAACTCGAGTTCATAAACTAAACCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016570.2-1514s21c1
Sequence:CCGGGAAGATGACGCCTTCTTATATCTCGAGATATAAGAAGGCGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016570.2-228s21c1
Sequence:CCGGGTGGAGGTACAGTTTCTCTAACTCGAGTTAGAGAAACTGTACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016570.1-759s1c1
Sequence:CCGGGAGAGCTTGTTCCAGCAATTACTCGAGTAATTGCTGGAACAAGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016570.1-398s1c1
Sequence:CCGGGCAGATGGTTTAGTTTATGAACTCGAGTTCATAAACTAAACCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016570.1-620s1c1
Sequence:CCGGGTCAATAAAGTAGCAGGGAATCTCGAGATTCCCTGCTACTTTATTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016570.1-1080s1c1
Sequence:CCGGGCATGTTACATGGAATTGGAACTCGAGTTCCAATTCCATGTAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016570.1-183s1c1
Sequence:CCGGGTGGAGGTACAGTTTCTCTAACTCGAGTTAGAGAAACTGTACCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016570
VALIDATED
ERGIC2 MISSION shRNA shRNA Plasmid DNA
ERGIC and golgi 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016570.2-801s21c1
Sequence:CCGGGAGAGCTTGTTCCAGCAATTACTCGAGTAATTGCTGGAACAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016570.2-443s21c1
Sequence:CCGGGCAGATGGTTTAGTTTATGAACTCGAGTTCATAAACTAAACCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016570.2-1514s21c1
Sequence:CCGGGAAGATGACGCCTTCTTATATCTCGAGATATAAGAAGGCGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016570.2-228s21c1
Sequence:CCGGGTGGAGGTACAGTTTCTCTAACTCGAGTTAGAGAAACTGTACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016570.1-759s1c1
Sequence:CCGGGAGAGCTTGTTCCAGCAATTACTCGAGTAATTGCTGGAACAAGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016570.1-398s1c1
Sequence:CCGGGCAGATGGTTTAGTTTATGAACTCGAGTTCATAAACTAAACCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016570.1-620s1c1
Sequence:CCGGGTCAATAAAGTAGCAGGGAATCTCGAGATTCCCTGCTACTTTATTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016570.1-1080s1c1
Sequence:CCGGGCATGTTACATGGAATTGGAACTCGAGTTCCAATTCCATGTAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016570.1-183s1c1
Sequence:CCGGGTGGAGGTACAGTTTCTCTAACTCGAGTTAGAGAAACTGTACCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016570
VALIDATED
ERGIC2 MISSION shRNA Lentiviral Transduction Particles
ERGIC and golgi 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016570.2-801s21c1
Sequence:CCGGGAGAGCTTGTTCCAGCAATTACTCGAGTAATTGCTGGAACAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016570.2-443s21c1
Sequence:CCGGGCAGATGGTTTAGTTTATGAACTCGAGTTCATAAACTAAACCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016570.2-1514s21c1
Sequence:CCGGGAAGATGACGCCTTCTTATATCTCGAGATATAAGAAGGCGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016570.2-228s21c1
Sequence:CCGGGTGGAGGTACAGTTTCTCTAACTCGAGTTAGAGAAACTGTACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016570.1-759s1c1
Sequence:CCGGGAGAGCTTGTTCCAGCAATTACTCGAGTAATTGCTGGAACAAGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016570.1-398s1c1
Sequence:CCGGGCAGATGGTTTAGTTTATGAACTCGAGTTCATAAACTAAACCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016570.1-620s1c1
Sequence:CCGGGTCAATAAAGTAGCAGGGAATCTCGAGATTCCCTGCTACTTTATTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016570.1-1080s1c1
Sequence:CCGGGCATGTTACATGGAATTGGAACTCGAGTTCCAATTCCATGTAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016570.1-183s1c1
Sequence:CCGGGTGGAGGTACAGTTTCTCTAACTCGAGTTAGAGAAACTGTACCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026168
VALIDATED
ERGIC2 MISSION shRNA Bacterial Glycerol Stock
ERGIC and golgi 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026168.3-262s21c1
Sequence:CCGGACATGGATGAAGTACGAATATCTCGAGATATTCGTACTTCATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026168.3-504s21c1
Sequence:CCGGTTCCCTTCAAGACGTGATATTCTCGAGAATATCACGTCTTGAAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026168.3-311s21c1
Sequence:CCGGTGCGAATCAACATAGACATTACTCGAGTAATGTCTATGTTGATTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026168.3-3249s21c1
Sequence:CCGGTTGTATATCTTGGCCTATAAACTCGAGTTTATAGGCCAAGATATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026168.3-947s21c1
Sequence:CCGGACGGCGTCTCTGGAATATTTACTCGAGTAAATATTCCAGAGACGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026168.1-143s1c1
Sequence:CCGGGTGAAAGAGTTAGATGCCTTTCTCGAGAAAGGCATCTAACTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026168.1-774s1c1
Sequence:CCGGGAGAGCTTGTTCCGGGAATTACTCGAGTAATTCCCGGAACAAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026168.1-2398s1c1
Sequence:CCGGCGGCAACAAATCAGCAGCAAACTCGAGTTTGCTGCTGATTTGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026168.1-416s1c1
Sequence:CCGGGCAGATGGTCTGGCTTATGAACTCGAGTTCATAAGCCAGACCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026168
VALIDATED
ERGIC2 MISSION shRNA shRNA Plasmid DNA
ERGIC and golgi 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026168.3-262s21c1
Sequence:CCGGACATGGATGAAGTACGAATATCTCGAGATATTCGTACTTCATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026168.3-504s21c1
Sequence:CCGGTTCCCTTCAAGACGTGATATTCTCGAGAATATCACGTCTTGAAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026168.3-311s21c1
Sequence:CCGGTGCGAATCAACATAGACATTACTCGAGTAATGTCTATGTTGATTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026168.3-3249s21c1
Sequence:CCGGTTGTATATCTTGGCCTATAAACTCGAGTTTATAGGCCAAGATATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026168.3-947s21c1
Sequence:CCGGACGGCGTCTCTGGAATATTTACTCGAGTAAATATTCCAGAGACGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026168.1-143s1c1
Sequence:CCGGGTGAAAGAGTTAGATGCCTTTCTCGAGAAAGGCATCTAACTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026168.1-774s1c1
Sequence:CCGGGAGAGCTTGTTCCGGGAATTACTCGAGTAATTCCCGGAACAAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026168.1-2398s1c1
Sequence:CCGGCGGCAACAAATCAGCAGCAAACTCGAGTTTGCTGCTGATTTGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026168.1-416s1c1
Sequence:CCGGGCAGATGGTCTGGCTTATGAACTCGAGTTCATAAGCCAGACCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026168
VALIDATED
ERGIC2 MISSION shRNA Lentiviral Transduction Particles
ERGIC and golgi 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026168.3-262s21c1
Sequence:CCGGACATGGATGAAGTACGAATATCTCGAGATATTCGTACTTCATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026168.3-504s21c1
Sequence:CCGGTTCCCTTCAAGACGTGATATTCTCGAGAATATCACGTCTTGAAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026168.3-311s21c1
Sequence:CCGGTGCGAATCAACATAGACATTACTCGAGTAATGTCTATGTTGATTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026168.3-3249s21c1
Sequence:CCGGTTGTATATCTTGGCCTATAAACTCGAGTTTATAGGCCAAGATATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026168.3-947s21c1
Sequence:CCGGACGGCGTCTCTGGAATATTTACTCGAGTAAATATTCCAGAGACGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026168.1-143s1c1
Sequence:CCGGGTGAAAGAGTTAGATGCCTTTCTCGAGAAAGGCATCTAACTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026168.1-774s1c1
Sequence:CCGGGAGAGCTTGTTCCGGGAATTACTCGAGTAATTCCCGGAACAAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026168.1-2398s1c1
Sequence:CCGGCGGCAACAAATCAGCAGCAAACTCGAGTTTGCTGCTGATTTGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026168.1-416s1c1
Sequence:CCGGGCAGATGGTCTGGCTTATGAACTCGAGTTCATAAGCCAGACCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks