EMAIL THIS PAGE TO A FRIEND

ERGIC3

ERGIC and golgi 3

120 Gene Product Result for
Synonyms: C20orf47 CGI-54 Erv46 NY-BR-84 PRO0989 SDBCAG84 dJ477O4.2
UniProtKB ID: Q9Y282, Q5JWS3, Q6ZWP7, Q9H276, Q9P1L3
Gene ID:
Mouse(66366) ERGIC and golgi 3
Rat(296306) ERGIC and golgi 3
Zebrafish(393990) ERGIC and golgi 3
domestic cat(101080703) ERGIC and golgi 3
cow(509546) ERGIC and golgi 3
Horse(100054794) ERGIC and golgi 3
dog(477212) ERGIC and golgi 3
chicken(419137) ERGIC and golgi 3
domestic guinea pig(100727935) ERGIC and golgi 3
naked mole-rat(101726506) ERGIC and golgi 3
sheep(101116752) ERGIC and golgi 3
Domestic Rabbit(100328706) ERGIC and golgi 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015966 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015966 Rosetta Predictions human pricing
NM_198398 Rosetta Predictions human pricing
NM_001106533 Rosetta Predictions rat pricing
NM_025516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224273 predicted 377
2 SASI_Hs01_00224274 predicted 299
3 SASI_Hs01_00224275 predicted 493
4 SASI_Hs01_00224276 predicted 294
5 SASI_Hs01_00224277 predicted 273
6 SASI_Hs01_00224278 predicted 310
7 SASI_Hs01_00224279 predicted 408
8 SASI_Hs01_00224280 predicted 367
9 SASI_Hs01_00224281 predicted 305
10 SASI_Hs01_00224282 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172826 predicted 373
2 SASI_Hs01_00172827 predicted 306
3 SASI_Hs01_00172828 predicted 493
4 SASI_Hs01_00172829 predicted 291
5 SASI_Hs01_00172830 predicted 275
6 SASI_Hs01_00172831 predicted 308
7 SASI_Hs01_00172832 predicted 413
8 SASI_Hs01_00172833 predicted 366
9 SASI_Hs01_00172834 predicted 297
10 SASI_Hs01_00172835 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219888 predicted 471
2 SASI_Rn02_00219889 predicted 392
3 SASI_Rn02_00219890 predicted 1086
4 SASI_Rn02_00219891 predicted 474
5 SASI_Rn02_00219892 predicted 923
6 SASI_Rn02_00219893 predicted 498
7 SASI_Rn02_00219894 predicted 266
8 SASI_Rn02_00219895 predicted 1070
9 SASI_Rn02_00219896 predicted 1043
10 SASI_Rn02_00219897 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027443 predicted 475
2 SASI_Mm01_00027444 predicted 712
3 SASI_Mm01_00027445 predicted 367
4 SASI_Mm01_00027446 predicted 243
5 SASI_Mm02_00328406 predicted 1021
6 SASI_Mm01_00027448 predicted 441
7 SASI_Mm01_00027449 predicted 477
8 SASI_Mm01_00027450 predicted 660
9 SASI_Mm01_00027451 predicted 741
10 SASI_Mm02_00328407 predicted 1010
11 SASI_Mm01_00027447 predicted 1071
12 SASI_Mm01_00027452 predicted 1030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015966
VALIDATED
ERGIC3 MISSION shRNA Bacterial Glycerol Stock
ERGIC and golgi 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015966.2-978s1c1
Sequence:CCGGCAGACATGAGAAGGTTGCCAACTCGAGTTGGCAACCTTCTCATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015966.2-672s1c1
Sequence:CCGGGTATGGCTTCTTGGAAGTCAACTCGAGTTGACTTCCAAGAAGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015966.2-315s1c1
Sequence:CCGGCTATCTGAGTATTGATGCCATCTCGAGATGGCATCAATACTCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015966.2-518s1c1
Sequence:CCGGCAGAAGATATCAAGTGCTGTACTCGAGTACAGCACTTGATATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015966.2-584s1c1
Sequence:CCGGCCTTCAAGAACCCAGATACTACTCGAGTAGTATCTGGGTTCTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015966.2-367s1c1
Sequence:CCGGGAACACAACCTGTTCAAGCAACTCGAGTTGCTTGAACAGGTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-672s21c1
Sequence:CCGGGTATGGCTTCTTGGAAGTCAACTCGAGTTGACTTCCAAGAAGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-802s21c1
Sequence:CCGGTACATCCAGCACCTGTCATTTCTCGAGAAATGACAGGTGCTGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-887s21c1
Sequence:CCGGCCATGATGTTCCAGTACTTTGCTCGAGCAAAGTACTGGAACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-367s21c1
Sequence:CCGGGAACACAACCTGTTCAAGCAACTCGAGTTGCTTGAACAGGTTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-978s21c1
Sequence:CCGGCAGACATGAGAAGGTTGCCAACTCGAGTTGGCAACCTTCTCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015966
VALIDATED
ERGIC3 MISSION shRNA shRNA Plasmid DNA
ERGIC and golgi 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015966.2-978s1c1
Sequence:CCGGCAGACATGAGAAGGTTGCCAACTCGAGTTGGCAACCTTCTCATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015966.2-672s1c1
Sequence:CCGGGTATGGCTTCTTGGAAGTCAACTCGAGTTGACTTCCAAGAAGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015966.2-315s1c1
Sequence:CCGGCTATCTGAGTATTGATGCCATCTCGAGATGGCATCAATACTCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015966.2-518s1c1
Sequence:CCGGCAGAAGATATCAAGTGCTGTACTCGAGTACAGCACTTGATATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015966.2-584s1c1
Sequence:CCGGCCTTCAAGAACCCAGATACTACTCGAGTAGTATCTGGGTTCTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015966.2-367s1c1
Sequence:CCGGGAACACAACCTGTTCAAGCAACTCGAGTTGCTTGAACAGGTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-672s21c1
Sequence:CCGGGTATGGCTTCTTGGAAGTCAACTCGAGTTGACTTCCAAGAAGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-802s21c1
Sequence:CCGGTACATCCAGCACCTGTCATTTCTCGAGAAATGACAGGTGCTGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-887s21c1
Sequence:CCGGCCATGATGTTCCAGTACTTTGCTCGAGCAAAGTACTGGAACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-367s21c1
Sequence:CCGGGAACACAACCTGTTCAAGCAACTCGAGTTGCTTGAACAGGTTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-978s21c1
Sequence:CCGGCAGACATGAGAAGGTTGCCAACTCGAGTTGGCAACCTTCTCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015966
VALIDATED
ERGIC3 MISSION shRNA Lentiviral Transduction Particles
ERGIC and golgi 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015966.2-978s1c1
Sequence:CCGGCAGACATGAGAAGGTTGCCAACTCGAGTTGGCAACCTTCTCATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015966.2-672s1c1
Sequence:CCGGGTATGGCTTCTTGGAAGTCAACTCGAGTTGACTTCCAAGAAGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015966.2-315s1c1
Sequence:CCGGCTATCTGAGTATTGATGCCATCTCGAGATGGCATCAATACTCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015966.2-518s1c1
Sequence:CCGGCAGAAGATATCAAGTGCTGTACTCGAGTACAGCACTTGATATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015966.2-584s1c1
Sequence:CCGGCCTTCAAGAACCCAGATACTACTCGAGTAGTATCTGGGTTCTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015966.2-367s1c1
Sequence:CCGGGAACACAACCTGTTCAAGCAACTCGAGTTGCTTGAACAGGTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-672s21c1
Sequence:CCGGGTATGGCTTCTTGGAAGTCAACTCGAGTTGACTTCCAAGAAGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-802s21c1
Sequence:CCGGTACATCCAGCACCTGTCATTTCTCGAGAAATGACAGGTGCTGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-887s21c1
Sequence:CCGGCCATGATGTTCCAGTACTTTGCTCGAGCAAAGTACTGGAACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-367s21c1
Sequence:CCGGGAACACAACCTGTTCAAGCAACTCGAGTTGCTTGAACAGGTTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015966.2-978s21c1
Sequence:CCGGCAGACATGAGAAGGTTGCCAACTCGAGTTGGCAACCTTCTCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025516
VALIDATED
ERGIC3 MISSION shRNA Bacterial Glycerol Stock
ERGIC and golgi 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025516.2-708s1c1
Sequence:CCGGCAACAGTCTCATGTGCATGTTCTCGAGAACATGCACATGAGACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025516.2-761s1c2
Sequence:CCGGCAACATGACACACTACATCAACTCGAGTTGATGTAGTGTGTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025516.2-350s1c1
Sequence:CCGGGTTCAAGAAACGACTAGACAACTCGAGTTGTCTAGTCGTTTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025516.2-243s1c1
Sequence:CCGGCTGAAGATCAACATCGATGTTCTCGAGAACATCGATGTTGATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025516.2-1019s1c1
Sequence:CCGGGCTCTCACCAATGATGGTGAACTCGAGTTCACCATCATTGGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025516.4-142s1c1
Sequence:CCGGCCTATCGGAGTTGCAGTATTACTCGAGTAATACTGCAACTCCGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025516.4-467s1c1
Sequence:CCGGGAAGACATCAAGTGCTGTAACCTCGAGGTTACAGCACTTGATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025516
VALIDATED
ERGIC3 MISSION shRNA shRNA Plasmid DNA
ERGIC and golgi 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025516.2-708s1c1
Sequence:CCGGCAACAGTCTCATGTGCATGTTCTCGAGAACATGCACATGAGACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025516.2-761s1c2
Sequence:CCGGCAACATGACACACTACATCAACTCGAGTTGATGTAGTGTGTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025516.2-350s1c1
Sequence:CCGGGTTCAAGAAACGACTAGACAACTCGAGTTGTCTAGTCGTTTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025516.2-243s1c1
Sequence:CCGGCTGAAGATCAACATCGATGTTCTCGAGAACATCGATGTTGATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025516.2-1019s1c1
Sequence:CCGGGCTCTCACCAATGATGGTGAACTCGAGTTCACCATCATTGGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025516.4-142s1c1
Sequence:CCGGCCTATCGGAGTTGCAGTATTACTCGAGTAATACTGCAACTCCGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025516.4-467s1c1
Sequence:CCGGGAAGACATCAAGTGCTGTAACCTCGAGGTTACAGCACTTGATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025516
VALIDATED
ERGIC3 MISSION shRNA Lentiviral Transduction Particles
ERGIC and golgi 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025516.2-708s1c1
Sequence:CCGGCAACAGTCTCATGTGCATGTTCTCGAGAACATGCACATGAGACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025516.2-761s1c2
Sequence:CCGGCAACATGACACACTACATCAACTCGAGTTGATGTAGTGTGTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025516.2-350s1c1
Sequence:CCGGGTTCAAGAAACGACTAGACAACTCGAGTTGTCTAGTCGTTTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025516.2-243s1c1
Sequence:CCGGCTGAAGATCAACATCGATGTTCTCGAGAACATCGATGTTGATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025516.2-1019s1c1
Sequence:CCGGGCTCTCACCAATGATGGTGAACTCGAGTTCACCATCATTGGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025516.4-142s1c1
Sequence:CCGGCCTATCGGAGTTGCAGTATTACTCGAGTAATACTGCAACTCCGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025516.4-467s1c1
Sequence:CCGGGAAGACATCAAGTGCTGTAACCTCGAGGTTACAGCACTTGATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks