EMAIL THIS PAGE TO A FRIEND

ERH

enhancer of rudimentary homolog (Drosophila)

79 Gene Product Result for
Synonyms: DROER
UniProtKB ID: P84090, B2R5H2, P70659, Q14259
Gene ID:
Mouse(13877) enhancer of rudimentary homolog (Drosophila)
Rat(681415) enhancer of rudimentary homolog (Drosophila)
Zebrafish(30475) enhancer of rudimentary homolog (Drosophila)
cow(508901) enhancer of rudimentary homolog (Drosophila)
domestic cat(101100060) enhancer of rudimentary homolog (Drosophila)
dog(480371) enhancer of rudimentary homolog (Drosophila)
chicken(423262) enhancer of rudimentary homolog (Drosophila)
sheep(101118702) enhancer of rudimentary homolog (Drosophila)
naked mole-rat(101709067) enhancer of rudimentary homolog (Drosophila)
domestic guinea pig(100713943) enhancer of rudimentary homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004450 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004450 Rosetta Predictions human pricing
NM_001109442 Rosetta Predictions rat pricing
NM_007951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149908 predicted 201
2 SASI_Hs01_00149909 predicted 206
3 SASI_Hs01_00149910 predicted 295
4 SASI_Hs01_00149912 predicted 202
5 SASI_Hs01_00149913 predicted 203
6 SASI_Hs01_00149914 predicted 295
7 SASI_Hs01_00149915 predicted 237
8 SASI_Hs02_00337631 predicted 296
9 SASI_Hs01_00149916 predicted 291
10 SASI_Hs01_00149917 predicted 228
11 SASI_Hs01_00149911 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109442 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248447 predicted 694
2 SASI_Rn02_00248448 predicted 840
3 SASI_Rn02_00248449 predicted 388
4 SASI_Rn02_00248450 predicted 816
5 SASI_Rn02_00248451 predicted 630
6 SASI_Rn02_00248452 predicted 839
7 SASI_Rn02_00248453 predicted 456
8 SASI_Rn02_00248454 predicted 529
9 SASI_Rn02_00248455 predicted 546
10 SASI_Rn02_00248456 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112263 predicted 737
2 SASI_Mm01_00112254 predicted 391
3 SASI_Mm01_00112255 predicted 452
4 SASI_Mm01_00112256 predicted 441
5 SASI_Mm01_00112257 predicted 405
6 SASI_Mm01_00112258 predicted 399
7 SASI_Mm01_00112259 predicted 430
8 SASI_Mm01_00112260 predicted 420
9 SASI_Mm01_00112261 predicted 383
10 SASI_Mm01_00112262 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004450
VALIDATED
ERH MISSION shRNA Bacterial Glycerol Stock
enhancer of rudimentary homolog (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004450.2-655s21c1
Sequence:CCGGCCAGTCCTTCAACTGTTCATACTCGAGTATGAACAGTTGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004450.2-129s21c1
Sequence:CCGGGCTGACTACGAATCTGTGAATCTCGAGATTCACAGATTCGTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004450.2-298s21c1
Sequence:CCGGCCCAGACATACCAGCCTTATACTCGAGTATAAGGCTGGTATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004450.2-277s21c1
Sequence:CCGGGCCTGGTTTACCGAGCTGATACTCGAGTATCAGCTCGGTAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004450.1-656s1c1
Sequence:CCGGCCAGTCCTTCAACTGTTCATACTCGAGTATGAACAGTTGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004450.1-312s1c1
Sequence:CCGGCCTTATAACAAAGACTGGATTCTCGAGAATCCAGTCTTTGTTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004450.1-277s1c1
Sequence:CCGGGCCTGGTTTACCGAGCTGATACTCGAGTATCAGCTCGGTAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004450.1-129s1c1
Sequence:CCGGGCTGACTACGAATCTGTGAATCTCGAGATTCACAGATTCGTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004450.1-298s1c1
Sequence:CCGGCCCAGACATACCAGCCTTATACTCGAGTATAAGGCTGGTATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004450
VALIDATED
ERH MISSION shRNA shRNA Plasmid DNA
enhancer of rudimentary homolog (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004450.2-655s21c1
Sequence:CCGGCCAGTCCTTCAACTGTTCATACTCGAGTATGAACAGTTGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004450.2-129s21c1
Sequence:CCGGGCTGACTACGAATCTGTGAATCTCGAGATTCACAGATTCGTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004450.2-298s21c1
Sequence:CCGGCCCAGACATACCAGCCTTATACTCGAGTATAAGGCTGGTATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004450.2-277s21c1
Sequence:CCGGGCCTGGTTTACCGAGCTGATACTCGAGTATCAGCTCGGTAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004450.1-656s1c1
Sequence:CCGGCCAGTCCTTCAACTGTTCATACTCGAGTATGAACAGTTGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004450.1-312s1c1
Sequence:CCGGCCTTATAACAAAGACTGGATTCTCGAGAATCCAGTCTTTGTTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004450.1-277s1c1
Sequence:CCGGGCCTGGTTTACCGAGCTGATACTCGAGTATCAGCTCGGTAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004450.1-129s1c1
Sequence:CCGGGCTGACTACGAATCTGTGAATCTCGAGATTCACAGATTCGTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004450.1-298s1c1
Sequence:CCGGCCCAGACATACCAGCCTTATACTCGAGTATAAGGCTGGTATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004450
VALIDATED
ERH MISSION shRNA Lentiviral Transduction Particles
enhancer of rudimentary homolog (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004450.2-655s21c1
Sequence:CCGGCCAGTCCTTCAACTGTTCATACTCGAGTATGAACAGTTGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004450.2-129s21c1
Sequence:CCGGGCTGACTACGAATCTGTGAATCTCGAGATTCACAGATTCGTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004450.2-298s21c1
Sequence:CCGGCCCAGACATACCAGCCTTATACTCGAGTATAAGGCTGGTATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004450.2-277s21c1
Sequence:CCGGGCCTGGTTTACCGAGCTGATACTCGAGTATCAGCTCGGTAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004450.1-656s1c1
Sequence:CCGGCCAGTCCTTCAACTGTTCATACTCGAGTATGAACAGTTGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004450.1-312s1c1
Sequence:CCGGCCTTATAACAAAGACTGGATTCTCGAGAATCCAGTCTTTGTTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004450.1-277s1c1
Sequence:CCGGGCCTGGTTTACCGAGCTGATACTCGAGTATCAGCTCGGTAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004450.1-129s1c1
Sequence:CCGGGCTGACTACGAATCTGTGAATCTCGAGATTCACAGATTCGTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004450.1-298s1c1
Sequence:CCGGCCCAGACATACCAGCCTTATACTCGAGTATAAGGCTGGTATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007951
VALIDATED
ERH MISSION shRNA Bacterial Glycerol Stock
enhancer of rudimentary homolog (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007951.1-392s1c1
Sequence:CCGGGCGTAGCTGTAGTGAACCAATCTCGAGATTGGTTCACTACAGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007951.1-165s1c1
Sequence:CCGGCCCTTCCATCACATACGATATCTCGAGATATCGTATGTGATGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007951.1-264s1c1
Sequence:CCGGGCCGTATAACAAAGACTGGATCTCGAGATCCAGTCTTTGTTATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007951.1-240s1c1
Sequence:CCGGCCGAGCTGATACACAGACATACTCGAGTATGTCTGTGTATCAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007951.1-82s1c1
Sequence:CCGGGCTGACTATGAGTCTGTGAATCTCGAGATTCACAGACTCATAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007951
VALIDATED
ERH MISSION shRNA shRNA Plasmid DNA
enhancer of rudimentary homolog (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007951.1-392s1c1
Sequence:CCGGGCGTAGCTGTAGTGAACCAATCTCGAGATTGGTTCACTACAGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007951.1-165s1c1
Sequence:CCGGCCCTTCCATCACATACGATATCTCGAGATATCGTATGTGATGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007951.1-264s1c1
Sequence:CCGGGCCGTATAACAAAGACTGGATCTCGAGATCCAGTCTTTGTTATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007951.1-240s1c1
Sequence:CCGGCCGAGCTGATACACAGACATACTCGAGTATGTCTGTGTATCAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007951.1-82s1c1
Sequence:CCGGGCTGACTATGAGTCTGTGAATCTCGAGATTCACAGACTCATAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007951
VALIDATED
ERH MISSION shRNA Lentiviral Transduction Particles
enhancer of rudimentary homolog (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007951.1-392s1c1
Sequence:CCGGGCGTAGCTGTAGTGAACCAATCTCGAGATTGGTTCACTACAGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007951.1-165s1c1
Sequence:CCGGCCCTTCCATCACATACGATATCTCGAGATATCGTATGTGATGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007951.1-264s1c1
Sequence:CCGGGCCGTATAACAAAGACTGGATCTCGAGATCCAGTCTTTGTTATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007951.1-240s1c1
Sequence:CCGGCCGAGCTGATACACAGACATACTCGAGTATGTCTGTGTATCAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007951.1-82s1c1
Sequence:CCGGGCTGACTATGAGTCTGTGAATCTCGAGATTCACAGACTCATAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks