EMAIL THIS PAGE TO A FRIEND

ERI1

exoribonuclease 1

117 Gene Product Result for
Synonyms: 3'HEXO HEXO THEX1
UniProtKB ID: Q8IV48, A8K4U7, Q9NSX3
Gene ID:
Mouse(67276) exoribonuclease 1
Rat(361159) exoribonuclease 1
Zebrafish(553641) exoribonuclease 1
domestic cat(101088323) exoribonuclease 1
cow(540728) exoribonuclease 1
cow(785868) exoribonuclease 1
Horse(100147421) exoribonuclease 1
dog(482882) exoribonuclease 1
chicken(422629) exoribonuclease 1
domestic guinea pig(100731618) exoribonuclease 1
naked mole-rat(101703353) exoribonuclease 1
sheep(101102618) exoribonuclease 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026067 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026067 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026067 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153332 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153332 Rosetta Predictions human pricing
NM_001014143 Rosetta Predictions rat pricing
NM_026067 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098336 predicted 756
2 SASI_Hs01_00098337 predicted 812
3 SASI_Hs02_00367182 predicted 361
4 SASI_Hs01_00098339 predicted 1359
5 SASI_Hs01_00098340 predicted 1226
6 SASI_Hs02_00367183 predicted 773
7 SASI_Hs01_00098342 predicted 462
8 SASI_Hs01_00098343 predicted 854
9 SASI_Hs01_00098344 predicted 983
10 SASI_Hs01_00098345 predicted 949
11 SASI_Hs01_00098338 predicted 234
12 SASI_Hs01_00098341 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080711 predicted 965
2 SASI_Rn01_00080712 predicted 1226
3 SASI_Rn01_00080713 predicted 755
4 SASI_Rn01_00080714 predicted 777
5 SASI_Rn01_00080715 predicted 1085
6 SASI_Rn01_00080716 predicted 1205
7 SASI_Rn01_00080717 predicted 848
8 SASI_Rn01_00080718 predicted 883
9 SASI_Rn01_00080719 predicted 769
10 SASI_Rn01_00080720 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067973 predicted 821
2 SASI_Mm01_00067974 predicted 1273
3 SASI_Mm01_00067975 predicted 696
4 SASI_Mm01_00067976 predicted 911
5 SASI_Mm01_00067977 predicted 1041
6 SASI_Mm01_00067978 predicted 938
7 SASI_Mm02_00329610 predicted 1053
8 SASI_Mm02_00329611 predicted 736
9 SASI_Mm01_00067982 predicted 1262
10 SASI_Mm02_00329612 predicted 296
11 SASI_Mm01_00067979 predicted 1204
12 SASI_Mm01_00067980 predicted 1085
13 SASI_Mm01_00067981 predicted 285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026067
VALIDATED
ERI1 MISSION shRNA Bacterial Glycerol Stock
exoribonuclease 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026067.2-920s1c1
Sequence:CCGGGCCAGACCAAACTAACAATAACTCGAGTTATTGTTAGTTTGGTCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026067.2-309s1c1
Sequence:CCGGCGCAATGACAAACGGTTGTATCTCGAGATACAACCGTTTGTCATTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026067.2-378s1c1
Sequence:CCGGGCTTGAAACAAGAGGAGTCAACTCGAGTTGACTCCTCTTGTTTCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026067.2-861s1c1
Sequence:CCGGCGCTAAGAAGTGGATCAATATCTCGAGATATTGATCCACTTCTTAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026067.2-4895s1c1
Sequence:CCGGCGGGTTTCAAATTCTTCGGTACTCGAGTACCGAAGAATTTGAAACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026067.3-913s21c1
Sequence:CCGGCGCTAAGAAGTGGATCAATATCTCGAGATATTGATCCACTTCTTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026067.3-430s21c1
Sequence:CCGGGCTTGAAACAAGAGGAGTCAACTCGAGTTGACTCCTCTTGTTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026067.3-1241s21c1
Sequence:CCGGAGGCGAATGAATCTGAGTTAACTCGAGTTAACTCAGATTCATTCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026067.3-640s21c1
Sequence:CCGGCACCTTAGAAATCGAAGATACCTCGAGGTATCTTCGATTTCTAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026067.3-972s21c1
Sequence:CCGGGCCAGACCAAACTAACAATAACTCGAGTTATTGTTAGTTTGGTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026067
VALIDATED
ERI1 MISSION shRNA shRNA Plasmid DNA
exoribonuclease 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026067.2-920s1c1
Sequence:CCGGGCCAGACCAAACTAACAATAACTCGAGTTATTGTTAGTTTGGTCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026067.2-309s1c1
Sequence:CCGGCGCAATGACAAACGGTTGTATCTCGAGATACAACCGTTTGTCATTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026067.2-378s1c1
Sequence:CCGGGCTTGAAACAAGAGGAGTCAACTCGAGTTGACTCCTCTTGTTTCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026067.2-861s1c1
Sequence:CCGGCGCTAAGAAGTGGATCAATATCTCGAGATATTGATCCACTTCTTAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026067.2-4895s1c1
Sequence:CCGGCGGGTTTCAAATTCTTCGGTACTCGAGTACCGAAGAATTTGAAACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026067.3-913s21c1
Sequence:CCGGCGCTAAGAAGTGGATCAATATCTCGAGATATTGATCCACTTCTTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026067.3-430s21c1
Sequence:CCGGGCTTGAAACAAGAGGAGTCAACTCGAGTTGACTCCTCTTGTTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026067.3-1241s21c1
Sequence:CCGGAGGCGAATGAATCTGAGTTAACTCGAGTTAACTCAGATTCATTCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026067.3-640s21c1
Sequence:CCGGCACCTTAGAAATCGAAGATACCTCGAGGTATCTTCGATTTCTAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026067.3-972s21c1
Sequence:CCGGGCCAGACCAAACTAACAATAACTCGAGTTATTGTTAGTTTGGTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026067
VALIDATED
ERI1 MISSION shRNA Lentiviral Transduction Particles
exoribonuclease 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026067.2-920s1c1
Sequence:CCGGGCCAGACCAAACTAACAATAACTCGAGTTATTGTTAGTTTGGTCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026067.2-309s1c1
Sequence:CCGGCGCAATGACAAACGGTTGTATCTCGAGATACAACCGTTTGTCATTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026067.2-378s1c1
Sequence:CCGGGCTTGAAACAAGAGGAGTCAACTCGAGTTGACTCCTCTTGTTTCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026067.2-861s1c1
Sequence:CCGGCGCTAAGAAGTGGATCAATATCTCGAGATATTGATCCACTTCTTAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026067.2-4895s1c1
Sequence:CCGGCGGGTTTCAAATTCTTCGGTACTCGAGTACCGAAGAATTTGAAACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026067.3-913s21c1
Sequence:CCGGCGCTAAGAAGTGGATCAATATCTCGAGATATTGATCCACTTCTTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026067.3-430s21c1
Sequence:CCGGGCTTGAAACAAGAGGAGTCAACTCGAGTTGACTCCTCTTGTTTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026067.3-1241s21c1
Sequence:CCGGAGGCGAATGAATCTGAGTTAACTCGAGTTAACTCAGATTCATTCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026067.3-640s21c1
Sequence:CCGGCACCTTAGAAATCGAAGATACCTCGAGGTATCTTCGATTTCTAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026067.3-972s21c1
Sequence:CCGGGCCAGACCAAACTAACAATAACTCGAGTTATTGTTAGTTTGGTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153332
VALIDATED
ERI1 MISSION shRNA Bacterial Glycerol Stock
exoribonuclease 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_153332.2-942s1c1
Sequence:CCGGGCCAAACCAAACTGACAATAACTCGAGTTATTGTCAGTTTGGTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_153332.2-400s1c1
Sequence:CCGGGCTTGAAACTAGAGGAGTAAACTCGAGTTTACTCCTCTAGTTTCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_153332.2-1605s1c1
Sequence:CCGGGCCTTTGGATTTCAAGAATATCTCGAGATATTCTTGAAATCCAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153332.2-332s1c1
Sequence:CCGGGCCATTACGAATGGCTGTATTCTCGAGAATACAGCCATTCGTAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_153332.2-681s1c1
Sequence:CCGGGCATCAGTCTAACTGGAATTACTCGAGTAATTCCAGTTAGACTGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153332.3-1717s21c1
Sequence:CCGGTGATTGGAAGGTAGATCTTATCTCGAGATAAGATCTACCTTCCAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153332.3-437s21c1
Sequence:CCGGTGACTTCAGTGACCCGGTTTACTCGAGTAAACCGGGTCACTGAAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153332.3-888s21c1
Sequence:CCGGGTAATTGACTGGATGAAATTGCTCGAGCAATTTCATCCAGTCAATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153332.3-988s21c1
Sequence:CCGGGTCAACTCAGCAGGCTCAAATCTCGAGATTTGAGCCTGCTGAGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153332.3-1280s21c1
Sequence:CCGGACCACCACAAATGCCACATTTCTCGAGAAATGTGGCATTTGTGGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153332
VALIDATED
ERI1 MISSION shRNA shRNA Plasmid DNA
exoribonuclease 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_153332.2-942s1c1
Sequence:CCGGGCCAAACCAAACTGACAATAACTCGAGTTATTGTCAGTTTGGTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_153332.2-400s1c1
Sequence:CCGGGCTTGAAACTAGAGGAGTAAACTCGAGTTTACTCCTCTAGTTTCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_153332.2-1605s1c1
Sequence:CCGGGCCTTTGGATTTCAAGAATATCTCGAGATATTCTTGAAATCCAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153332.2-332s1c1
Sequence:CCGGGCCATTACGAATGGCTGTATTCTCGAGAATACAGCCATTCGTAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_153332.2-681s1c1
Sequence:CCGGGCATCAGTCTAACTGGAATTACTCGAGTAATTCCAGTTAGACTGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153332.3-1717s21c1
Sequence:CCGGTGATTGGAAGGTAGATCTTATCTCGAGATAAGATCTACCTTCCAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153332.3-437s21c1
Sequence:CCGGTGACTTCAGTGACCCGGTTTACTCGAGTAAACCGGGTCACTGAAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153332.3-888s21c1
Sequence:CCGGGTAATTGACTGGATGAAATTGCTCGAGCAATTTCATCCAGTCAATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153332.3-988s21c1
Sequence:CCGGGTCAACTCAGCAGGCTCAAATCTCGAGATTTGAGCCTGCTGAGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153332.3-1280s21c1
Sequence:CCGGACCACCACAAATGCCACATTTCTCGAGAAATGTGGCATTTGTGGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153332
VALIDATED
ERI1 MISSION shRNA Lentiviral Transduction Particles
exoribonuclease 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_153332.2-942s1c1
Sequence:CCGGGCCAAACCAAACTGACAATAACTCGAGTTATTGTCAGTTTGGTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_153332.2-400s1c1
Sequence:CCGGGCTTGAAACTAGAGGAGTAAACTCGAGTTTACTCCTCTAGTTTCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_153332.2-1605s1c1
Sequence:CCGGGCCTTTGGATTTCAAGAATATCTCGAGATATTCTTGAAATCCAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153332.2-332s1c1
Sequence:CCGGGCCATTACGAATGGCTGTATTCTCGAGAATACAGCCATTCGTAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_153332.2-681s1c1
Sequence:CCGGGCATCAGTCTAACTGGAATTACTCGAGTAATTCCAGTTAGACTGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153332.3-1717s21c1
Sequence:CCGGTGATTGGAAGGTAGATCTTATCTCGAGATAAGATCTACCTTCCAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153332.3-437s21c1
Sequence:CCGGTGACTTCAGTGACCCGGTTTACTCGAGTAAACCGGGTCACTGAAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153332.3-888s21c1
Sequence:CCGGGTAATTGACTGGATGAAATTGCTCGAGCAATTTCATCCAGTCAATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153332.3-988s21c1
Sequence:CCGGGTCAACTCAGCAGGCTCAAATCTCGAGATTTGAGCCTGCTGAGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153332.3-1280s21c1
Sequence:CCGGACCACCACAAATGCCACATTTCTCGAGAAATGTGGCATTTGTGGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)