EMAIL THIS PAGE TO A FRIEND

ERI3

ERI1 exoribonuclease family member 3

94 Gene Product Result for
Synonyms: PINT1 PRNPIP
Gene ID:
Mouse(140546) exoribonuclease 3
Rat(313535) ERI1 exoribonuclease family member 3
chicken(424579) ERI1 exoribonuclease family member 3
cow(540516) ERI1 exoribonuclease family member 3
Horse(100052964) ERI1 exoribonuclease family member 3
domestic cat(101086162) ERI1 exoribonuclease family member 3
dog(475384) ERI1 exoribonuclease family member 3
domestic guinea pig(100721100) ERI1 exoribonuclease family member 3
naked mole-rat(101696519) ERI1 exoribonuclease family member 3
sheep(101116000) ERI1 exoribonuclease family member 3
Domestic Rabbit(100350660) ERI1 exoribonuclease family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024066 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024066 Rosetta Predictions human pricing
XM_001071982 Rosetta Predictions rat pricing
XM_233435 Rosetta Predictions rat pricing
NM_080469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016057 predicted 780
2 SASI_Hs01_00016058 predicted 1207
3 SASI_Hs01_00016059 predicted 1091
4 SASI_Hs01_00016060 predicted 485
5 SASI_Hs01_00016061 predicted 859
6 SASI_Hs01_00016062 predicted 417
7 SASI_Hs01_00016063 predicted 1211
8 SASI_Hs01_00016064 predicted 1411
9 SASI_Hs01_00016065 predicted 932
10 SASI_Hs01_00016066 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337231 predicted 1390
2 SASI_Rn02_00337232 predicted 868
3 SASI_Rn02_00337233 predicted 199
4 SASI_Rn02_00337234 predicted 1066
5 SASI_Rn02_00337235 predicted 719
6 SASI_Rn02_00337236 predicted 1228
7 SASI_Rn02_00337237 predicted 1084
8 SASI_Rn02_00337238 predicted 1454
9 SASI_Rn02_00337239 predicted 1527
10 SASI_Rn02_00337240 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233435 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387772 predicted 1001
2 SASI_Rn02_00387773 predicted 798
3 SASI_Rn02_00387774 predicted 645
4 SASI_Rn02_00387775 predicted 676
5 SASI_Rn02_00387776 predicted 941
6 SASI_Rn02_00387777 predicted 635
7 SASI_Rn02_00387778 predicted 966
8 SASI_Rn02_00387779 predicted 611
9 SASI_Rn02_00387780 predicted 789
10 SASI_Rn02_00387781 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151599 predicted 953
2 SASI_Mm01_00151600 predicted 635
3 SASI_Mm01_00151602 predicted 293
4 SASI_Mm01_00151603 predicted 649
5 SASI_Mm01_00151604 predicted 790
6 SASI_Mm01_00151606 predicted 283
7 SASI_Mm01_00151607 predicted 441
8 SASI_Mm01_00151608 predicted 628
9 SASI_Mm02_00338144 predicted 1033
10 SASI_Mm02_00338145 predicted 694
11 SASI_Mm01_00151601 predicted 1029
12 SASI_Mm01_00151605 predicted 1097
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080469
VALIDATED
ERI3 MISSION shRNA Bacterial Glycerol Stock
ERI1 exoribonuclease family member 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080469.2-633s1c1
Sequence:CCGGCATGGAAATCGAGTCTACCTTCTCGAGAAGGTAGACTCGATTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080469.2-901s1c1
Sequence:CCGGGATTACTTCAAGCAGTGGATTCTCGAGAATCCACTGCTTGAAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080469.2-808s1c1
Sequence:CCGGCCAAACGTCAAGTCAATCTTTCTCGAGAAAGATTGACTTGACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080469.2-364s1c1
Sequence:CCGGGCTCGGTTCTCTTCATATTTACTCGAGTAAATATGAAGAGAACCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080469.3-633s21c1
Sequence:CCGGCATGGAAATCGAGTCTACCTTCTCGAGAAGGTAGACTCGATTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080469.3-901s21c1
Sequence:CCGGGATTACTTCAAGCAGTGGATTCTCGAGAATCCACTGCTTGAAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080469.3-808s21c1
Sequence:CCGGCCAAACGTCAAGTCAATCTTTCTCGAGAAAGATTGACTTGACGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080469.3-364s21c1
Sequence:CCGGGCTCGGTTCTCTTCATATTTACTCGAGTAAATATGAAGAGAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080469
VALIDATED
ERI3 MISSION shRNA shRNA Plasmid DNA
ERI1 exoribonuclease family member 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080469.2-633s1c1
Sequence:CCGGCATGGAAATCGAGTCTACCTTCTCGAGAAGGTAGACTCGATTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080469.2-901s1c1
Sequence:CCGGGATTACTTCAAGCAGTGGATTCTCGAGAATCCACTGCTTGAAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080469.2-808s1c1
Sequence:CCGGCCAAACGTCAAGTCAATCTTTCTCGAGAAAGATTGACTTGACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080469.2-364s1c1
Sequence:CCGGGCTCGGTTCTCTTCATATTTACTCGAGTAAATATGAAGAGAACCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080469.3-633s21c1
Sequence:CCGGCATGGAAATCGAGTCTACCTTCTCGAGAAGGTAGACTCGATTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080469.3-901s21c1
Sequence:CCGGGATTACTTCAAGCAGTGGATTCTCGAGAATCCACTGCTTGAAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080469.3-808s21c1
Sequence:CCGGCCAAACGTCAAGTCAATCTTTCTCGAGAAAGATTGACTTGACGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080469.3-364s21c1
Sequence:CCGGGCTCGGTTCTCTTCATATTTACTCGAGTAAATATGAAGAGAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080469
VALIDATED
ERI3 MISSION shRNA Lentiviral Transduction Particles
ERI1 exoribonuclease family member 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080469.2-633s1c1
Sequence:CCGGCATGGAAATCGAGTCTACCTTCTCGAGAAGGTAGACTCGATTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080469.2-901s1c1
Sequence:CCGGGATTACTTCAAGCAGTGGATTCTCGAGAATCCACTGCTTGAAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080469.2-808s1c1
Sequence:CCGGCCAAACGTCAAGTCAATCTTTCTCGAGAAAGATTGACTTGACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080469.2-364s1c1
Sequence:CCGGGCTCGGTTCTCTTCATATTTACTCGAGTAAATATGAAGAGAACCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080469.3-633s21c1
Sequence:CCGGCATGGAAATCGAGTCTACCTTCTCGAGAAGGTAGACTCGATTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080469.3-901s21c1
Sequence:CCGGGATTACTTCAAGCAGTGGATTCTCGAGAATCCACTGCTTGAAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080469.3-808s21c1
Sequence:CCGGCCAAACGTCAAGTCAATCTTTCTCGAGAAAGATTGACTTGACGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080469.3-364s21c1
Sequence:CCGGGCTCGGTTCTCTTCATATTTACTCGAGTAAATATGAAGAGAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024066
VALIDATED
ERI3 MISSION shRNA Bacterial Glycerol Stock
ERI1 exoribonuclease family member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024066.1-393s1c1
Sequence:CCGGCTCTCACAGAACCTTCAGCATCTCGAGATGCTGAAGGTTCTGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024066.1-778s1c1
Sequence:CCGGGATTGAGTCTACCTTTCACATCTCGAGATGTGAAAGGTAGACTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024066.1-1105s1c1
Sequence:CCGGGAATGGACTTCTAGACATGAACTCGAGTTCATGTCTAGAAGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024066.1-944s1c1
Sequence:CCGGGATCCAAACGTCAAGTCAATTCTCGAGAATTGACTTGACGTTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024066.1-1180s1c1
Sequence:CCGGCAAGAACATTGCCAACATCATCTCGAGATGATGTTGGCAATGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024066.1-1225s1c1
Sequence:CCGGCATCTTCAAGCAGACATCGAACTCGAGTTCGATGTCTGCTTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_024066.1-850s1c1
Sequence:CCGGCACCGGGATTATTCAAGCCATCTCGAGATGGCTTGAATAATCCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024066.1-1221s1c1
Sequence:CCGGGCTTCATCTTCAAGCAGACATCTCGAGATGTCTGCTTGAAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024066.1-725s1c1
Sequence:CCGGCCTCAGGAAATCATCGAGTTCCTCGAGGAACTCGATGATTTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024066
VALIDATED
ERI3 MISSION shRNA shRNA Plasmid DNA
ERI1 exoribonuclease family member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024066.1-393s1c1
Sequence:CCGGCTCTCACAGAACCTTCAGCATCTCGAGATGCTGAAGGTTCTGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024066.1-778s1c1
Sequence:CCGGGATTGAGTCTACCTTTCACATCTCGAGATGTGAAAGGTAGACTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024066.1-1105s1c1
Sequence:CCGGGAATGGACTTCTAGACATGAACTCGAGTTCATGTCTAGAAGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024066.1-944s1c1
Sequence:CCGGGATCCAAACGTCAAGTCAATTCTCGAGAATTGACTTGACGTTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024066.1-1180s1c1
Sequence:CCGGCAAGAACATTGCCAACATCATCTCGAGATGATGTTGGCAATGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024066.1-1225s1c1
Sequence:CCGGCATCTTCAAGCAGACATCGAACTCGAGTTCGATGTCTGCTTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_024066.1-850s1c1
Sequence:CCGGCACCGGGATTATTCAAGCCATCTCGAGATGGCTTGAATAATCCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024066.1-1221s1c1
Sequence:CCGGGCTTCATCTTCAAGCAGACATCTCGAGATGTCTGCTTGAAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024066.1-725s1c1
Sequence:CCGGCCTCAGGAAATCATCGAGTTCCTCGAGGAACTCGATGATTTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024066
VALIDATED
ERI3 MISSION shRNA Lentiviral Transduction Particles
ERI1 exoribonuclease family member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024066.1-393s1c1
Sequence:CCGGCTCTCACAGAACCTTCAGCATCTCGAGATGCTGAAGGTTCTGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024066.1-778s1c1
Sequence:CCGGGATTGAGTCTACCTTTCACATCTCGAGATGTGAAAGGTAGACTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024066.1-1105s1c1
Sequence:CCGGGAATGGACTTCTAGACATGAACTCGAGTTCATGTCTAGAAGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024066.1-944s1c1
Sequence:CCGGGATCCAAACGTCAAGTCAATTCTCGAGAATTGACTTGACGTTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024066.1-1180s1c1
Sequence:CCGGCAAGAACATTGCCAACATCATCTCGAGATGATGTTGGCAATGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024066.1-1225s1c1
Sequence:CCGGCATCTTCAAGCAGACATCGAACTCGAGTTCGATGTCTGCTTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_024066.1-850s1c1
Sequence:CCGGCACCGGGATTATTCAAGCCATCTCGAGATGGCTTGAATAATCCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024066.1-1221s1c1
Sequence:CCGGGCTTCATCTTCAAGCAGACATCTCGAGATGTCTGCTTGAAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024066.1-725s1c1
Sequence:CCGGCCTCAGGAAATCATCGAGTTCCTCGAGGAACTCGATGATTTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks