EMAIL THIS PAGE TO A FRIEND

ERICH1

glutamate-rich 1

74 Gene Product Result for
UniProtKB ID: Q86X53, A8K2J9, Q9P063
Gene ID:
Mouse(234086) glutamate rich 1
Rat(306622) glutamate-rich 1
chicken(421904) glutamate-rich 1
cow(513044) glutamate-rich 1
domestic cat(101081289) glutamate-rich 1
dog(488554) glutamate-rich 1
sheep(101102370) glutamate-rich 1
naked mole-rat(101699340) glutamate-rich 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003725 Anti-ERICH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207332 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001034862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207332 Rosetta Predictions human pricing
NM_001127680 Rosetta Predictions rat pricing
NM_001034862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048910 predicted 1532
2 SASI_Hs01_00048912 predicted 1368
3 SASI_Hs01_00048913 predicted 1486
4 SASI_Hs01_00048914 predicted 1474
5 SASI_Hs01_00048915 predicted 207
6 SASI_Hs01_00048917 predicted 1317
7 SASI_Hs01_00048918 predicted 1317
8 SASI_Hs01_00048919 predicted 1495
9 SASI_Hs02_00373878 predicted 1335
10 SASI_Hs02_00373879 predicted 1255
11 SASI_Hs01_00048911 predicted 1096
12 SASI_Hs01_00048916 predicted 1363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254830 predicted 406
2 SASI_Rn02_00254831 predicted 880
3 SASI_Rn02_00254832 predicted 321
4 SASI_Rn02_00254833 predicted 291
5 SASI_Rn02_00254834 predicted 770
6 SASI_Rn02_00254835 predicted 394
7 SASI_Rn02_00254836 predicted 512
8 SASI_Rn02_00254837 predicted 387
9 SASI_Rn02_00254838 predicted 293
10 SASI_Rn02_00254839 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289110 predicted 462
2 SASI_Mm02_00289111 predicted 766
3 SASI_Mm02_00289112 predicted 466
4 SASI_Mm02_00289113 predicted 278
5 SASI_Mm02_00289114 predicted 878
6 SASI_Mm02_00289115 predicted 440
7 SASI_Mm02_00289116 predicted 948
8 SASI_Mm02_00289117 predicted 369
9 SASI_Mm02_00289118 predicted 414
10 SASI_Mm02_00289119 predicted 987
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207332
VALIDATED
ERICH1 MISSION shRNA Bacterial Glycerol Stock
glutamate-rich 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-518s21c1
Sequence:CCGGCACAGATGGCACCACAATAAGCTCGAGCTTATTGTGGTGCCATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-1122s21c1
Sequence:CCGGTATGACGGTGTCTCCAGAGATCTCGAGATCTCTGGAGACACCGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207332.1-1524s21c1
Sequence:CCGGTTTGTTCCTGGTGGGCAAGATCTCGAGATCTTGCCCACCAGGAACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-375s21c1
Sequence:CCGGGATCCTCATGACCAGCCAAAGCTCGAGCTTTGGCTGGTCATGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-612s21c1
Sequence:CCGGGCTGCTGGTGTCAGTTTCATGCTCGAGCATGAAACTGACACCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-489s21c1
Sequence:CCGGCTGTTACAGGAGAAATCTCAGCTCGAGCTGAGATTTCTCCTGTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-1094s21c1
Sequence:CCGGTTTGAAGTCAACACAGGAAATCTCGAGATTTCCTGTGTTGACTTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207332.1-1638s21c1
Sequence:CCGGATTCTGTTTCTCTACTTATTGCTCGAGCAATAAGTAGAGAAACAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207332.1-1552s21c1
Sequence:CCGGGAGGCTTCAGATGAGAAATTGCTCGAGCAATTTCTCATCTGAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207332.1-209s1c1
Sequence:CCGGCCAGAAACATGCTGAGCCTTTCTCGAGAAAGGCTCAGCATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207332.1-1287s1c1
Sequence:CCGGCTGGAAATGTTCCCAGAACATCTCGAGATGTTCTGGGAACATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207332.1-1448s1c1
Sequence:CCGGGACAAATGTGAGATGGGCTTACTCGAGTAAGCCCATCTCACATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207332.1-1469s1c1
Sequence:CCGGGAGTTAGTTCTCTGGGAACTTCTCGAGAAGTTCCCAGAGAACTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207332.1-483s1c1
Sequence:CCGGCAGAGTCTGTTACAGGAGAAACTCGAGTTTCTCCTGTAACAGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207332.1-1256s1c1
Sequence:CCGGCCTGCAAGATACTGAGAGATTCTCGAGAATCTCTCAGTATCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207332
VALIDATED
ERICH1 MISSION shRNA shRNA Plasmid DNA
glutamate-rich 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-518s21c1
Sequence:CCGGCACAGATGGCACCACAATAAGCTCGAGCTTATTGTGGTGCCATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-1122s21c1
Sequence:CCGGTATGACGGTGTCTCCAGAGATCTCGAGATCTCTGGAGACACCGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207332.1-1524s21c1
Sequence:CCGGTTTGTTCCTGGTGGGCAAGATCTCGAGATCTTGCCCACCAGGAACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-375s21c1
Sequence:CCGGGATCCTCATGACCAGCCAAAGCTCGAGCTTTGGCTGGTCATGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-612s21c1
Sequence:CCGGGCTGCTGGTGTCAGTTTCATGCTCGAGCATGAAACTGACACCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-489s21c1
Sequence:CCGGCTGTTACAGGAGAAATCTCAGCTCGAGCTGAGATTTCTCCTGTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-1094s21c1
Sequence:CCGGTTTGAAGTCAACACAGGAAATCTCGAGATTTCCTGTGTTGACTTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207332.1-1638s21c1
Sequence:CCGGATTCTGTTTCTCTACTTATTGCTCGAGCAATAAGTAGAGAAACAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207332.1-1552s21c1
Sequence:CCGGGAGGCTTCAGATGAGAAATTGCTCGAGCAATTTCTCATCTGAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207332.1-209s1c1
Sequence:CCGGCCAGAAACATGCTGAGCCTTTCTCGAGAAAGGCTCAGCATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207332.1-1287s1c1
Sequence:CCGGCTGGAAATGTTCCCAGAACATCTCGAGATGTTCTGGGAACATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207332.1-1448s1c1
Sequence:CCGGGACAAATGTGAGATGGGCTTACTCGAGTAAGCCCATCTCACATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207332.1-1469s1c1
Sequence:CCGGGAGTTAGTTCTCTGGGAACTTCTCGAGAAGTTCCCAGAGAACTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207332.1-483s1c1
Sequence:CCGGCAGAGTCTGTTACAGGAGAAACTCGAGTTTCTCCTGTAACAGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207332.1-1256s1c1
Sequence:CCGGCCTGCAAGATACTGAGAGATTCTCGAGAATCTCTCAGTATCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207332
VALIDATED
ERICH1 MISSION shRNA Lentiviral Transduction Particles
glutamate-rich 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-518s21c1
Sequence:CCGGCACAGATGGCACCACAATAAGCTCGAGCTTATTGTGGTGCCATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-1122s21c1
Sequence:CCGGTATGACGGTGTCTCCAGAGATCTCGAGATCTCTGGAGACACCGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207332.1-1524s21c1
Sequence:CCGGTTTGTTCCTGGTGGGCAAGATCTCGAGATCTTGCCCACCAGGAACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-375s21c1
Sequence:CCGGGATCCTCATGACCAGCCAAAGCTCGAGCTTTGGCTGGTCATGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-612s21c1
Sequence:CCGGGCTGCTGGTGTCAGTTTCATGCTCGAGCATGAAACTGACACCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-489s21c1
Sequence:CCGGCTGTTACAGGAGAAATCTCAGCTCGAGCTGAGATTTCTCCTGTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207332.1-1094s21c1
Sequence:CCGGTTTGAAGTCAACACAGGAAATCTCGAGATTTCCTGTGTTGACTTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207332.1-1638s21c1
Sequence:CCGGATTCTGTTTCTCTACTTATTGCTCGAGCAATAAGTAGAGAAACAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207332.1-1552s21c1
Sequence:CCGGGAGGCTTCAGATGAGAAATTGCTCGAGCAATTTCTCATCTGAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207332.1-209s1c1
Sequence:CCGGCCAGAAACATGCTGAGCCTTTCTCGAGAAAGGCTCAGCATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207332.1-1287s1c1
Sequence:CCGGCTGGAAATGTTCCCAGAACATCTCGAGATGTTCTGGGAACATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207332.1-1448s1c1
Sequence:CCGGGACAAATGTGAGATGGGCTTACTCGAGTAAGCCCATCTCACATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207332.1-1469s1c1
Sequence:CCGGGAGTTAGTTCTCTGGGAACTTCTCGAGAAGTTCCCAGAGAACTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207332.1-483s1c1
Sequence:CCGGCAGAGTCTGTTACAGGAGAAACTCGAGTTTCTCCTGTAACAGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207332.1-1256s1c1
Sequence:CCGGCCTGCAAGATACTGAGAGATTCTCGAGAATCTCTCAGTATCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034862
ERICH1 MISSION shRNA Bacterial Glycerol Stock
glutamate-rich 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034862.2-1375s21c1
Sequence:CCGGAGACATTTCTACCACGTTATTCTCGAGAATAACGTGGTAGAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034862.2-1021s21c1
Sequence:CCGGATTATTGGATCACGCAGATTCCTCGAGGAATCTGCGTGATCCAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034862.2-435s21c1
Sequence:CCGGACAAACCTCAGTGACGTTATTCTCGAGAATAACGTCACTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034862.2-281s21c1
Sequence:CCGGTTTGCCTCCTCAAGGGTATATCTCGAGATATACCCTTGAGGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034862.2-226s21c1
Sequence:CCGGGTCTGACAGATGGTGACATTACTCGAGTAATGTCACCATCTGTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034862
ERICH1 MISSION shRNA shRNA Plasmid DNA
glutamate-rich 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034862.2-1375s21c1
Sequence:CCGGAGACATTTCTACCACGTTATTCTCGAGAATAACGTGGTAGAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034862.2-1021s21c1
Sequence:CCGGATTATTGGATCACGCAGATTCCTCGAGGAATCTGCGTGATCCAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034862.2-435s21c1
Sequence:CCGGACAAACCTCAGTGACGTTATTCTCGAGAATAACGTCACTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034862.2-281s21c1
Sequence:CCGGTTTGCCTCCTCAAGGGTATATCTCGAGATATACCCTTGAGGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034862.2-226s21c1
Sequence:CCGGGTCTGACAGATGGTGACATTACTCGAGTAATGTCACCATCTGTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034862
ERICH1 MISSION shRNA Lentiviral Transduction Particles
glutamate-rich 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034862.2-1375s21c1
Sequence:CCGGAGACATTTCTACCACGTTATTCTCGAGAATAACGTGGTAGAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034862.2-1021s21c1
Sequence:CCGGATTATTGGATCACGCAGATTCCTCGAGGAATCTGCGTGATCCAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034862.2-435s21c1
Sequence:CCGGACAAACCTCAGTGACGTTATTCTCGAGAATAACGTCACTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034862.2-281s21c1
Sequence:CCGGTTTGCCTCCTCAAGGGTATATCTCGAGATATACCCTTGAGGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034862.2-226s21c1
Sequence:CCGGGTCTGACAGATGGTGACATTACTCGAGTAATGTCACCATCTGTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks