EMAIL THIS PAGE TO A FRIEND

ERICH2

glutamate-rich 2

80 Gene Product Result for
UniProtKB ID: A1L162, A7E2T7
Gene ID:
Mouse(66748) glutamate rich 2
Rat(499806) glutamate-rich 2
cow(615113) glutamate-rich 2
naked mole-rat(101725204) glutamate-rich 2
sheep(101117821) glutamate-rich 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU159581 MISSION® esiRNA esiRNA targeting mouse 4933404M02Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714892 Rosetta Predictions human pricing
XM_209489 Rosetta Predictions human pricing
XM_939141 Rosetta Predictions human pricing
NM_001024311 Rosetta Predictions rat pricing
NM_025744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00400066 predicted 294
2 SASI_Hs02_00400067 predicted 709
3 SASI_Hs02_00400068 predicted 521
4 SASI_Hs02_00400069 predicted 282
5 SASI_Hs02_00400070 predicted 294
6 SASI_Hs02_00400071 predicted 714
7 SASI_Hs02_00400072 predicted 115
8 SASI_Hs02_00400073 predicted 122
9 SASI_Hs02_00400074 predicted 130
10 SASI_Hs02_00400075 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_209489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478965 predicted 294
2 SASI_Hs01_00270161 predicted 710
3 SASI_Hs01_00270162 predicted 524
4 SASI_Hs01_00270166 predicted 285
5 SASI_Hs01_00270167 predicted 294
6 SASI_Hs01_00270168 predicted 706
7 SASI_Hs02_00478966 predicted 118
8 SASI_Hs02_00478967 predicted 121
9 SASI_Hs02_00478968 predicted 130
10 SASI_Hs01_00270170 predicted 323
11 SASI_Hs01_00270163 predicted 488
12 SASI_Hs01_00270164 predicted 517
13 SASI_Hs01_00270165 predicted 438
14 SASI_Hs01_00270169 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483492 predicted 296
2 SASI_Hs02_00483493 predicted 709
3 SASI_Hs02_00483494 predicted 527
4 SASI_Hs02_00483495 predicted 289
5 SASI_Hs02_00483496 predicted 296
6 SASI_Hs02_00483497 predicted 713
7 SASI_Hs02_00483498 predicted 118
8 SASI_Hs02_00483499 predicted 122
9 SASI_Hs02_00483500 predicted 126
10 SASI_Hs02_00483501 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202518 predicted 1020
2 SASI_Rn01_00044488 predicted 859
3 SASI_Rn01_00044490 predicted 755
4 SASI_Rn01_00044491 predicted 798
5 SASI_Rn01_00044492 predicted 844
6 SASI_Rn01_00044493 predicted 1377
7 SASI_Rn01_00044494 predicted 1427
8 SASI_Rn01_00044495 predicted 1309
9 SASI_Rn01_00044496 predicted 1206
10 SASI_Rn01_00044497 predicted 815
11 SASI_Rn01_00044489 predicted 1323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328925 predicted 1023
2 SASI_Mm01_00127156 predicted 823
3 SASI_Mm02_00328926 predicted 1093
4 SASI_Mm02_00328927 predicted 1412
5 SASI_Mm02_00328928 predicted 1291
6 SASI_Mm02_00328929 predicted 1106
7 SASI_Mm02_00328930 predicted 1278
8 SASI_Mm02_00328931 predicted 1246
9 SASI_Mm02_00328932 predicted 1308
10 SASI_Mm02_00328933 predicted 1311
11 SASI_Mm01_00127147 predicted 762
12 SASI_Mm01_00127148 predicted 767
13 SASI_Mm01_00127149 predicted 770
14 SASI_Mm01_00127150 predicted 759
15 SASI_Mm01_00127151 predicted 769
16 SASI_Mm01_00127152 predicted 780
17 SASI_Mm01_00127153 predicted 763
18 SASI_Mm01_00127154 predicted 761
19 SASI_Mm01_00127155 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025744
VALIDATED
ERICH2 MISSION shRNA Bacterial Glycerol Stock
glutamate-rich 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.1-835s1c1
Sequence:CCGGGAAACCAGTTGCTTAAGTCTTCTCGAGAAGACTTAAGCAACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.1-321s1c1
Sequence:CCGGCTTTCTCAAAGTAACCAGGATCTCGAGATCCTGGTTACTTTGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.1-845s1c1
Sequence:CCGGGCTTAAGTCTTAGCCCTGAATCTCGAGATTCAGGGCTAAGACTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025744.2-1527s21c1
Sequence:CCGGTCACTTATTGAAGAGATATTGCTCGAGCAATATCTCTTCAATAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025744.2-314s21c1
Sequence:CCGGTCCGGCCTTTCTCAAAGTAACCTCGAGGTTACTTTGAGAAAGGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025744.2-1106s21c1
Sequence:CCGGTTCAAAGAAGAGCGAAGATAACTCGAGTTATCTTCGCTCTTCTTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025744.2-846s21c1
Sequence:CCGGTTAAGTCTTAGCCCTGAATTTCTCGAGAAATTCAGGGCTAAGACTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.2-1108s1c1
Sequence:CCGGCAAAGAAGAGCGAAGATAAAGCTCGAGCTTTATCTTCGCTCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.2-1474s1c1
Sequence:CCGGGTCAGATGATCCTAATCTATGCTCGAGCATAGATTAGGATCATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.2-1025s1c1
Sequence:CCGGGAGATTATCAAACAAGCTTTACTCGAGTAAAGCTTGTTTGATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025744.2-1469s21c1
Sequence:CCGGATTATGTCAGATGATCCTAATCTCGAGATTAGGATCATCTGACATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025744
VALIDATED
ERICH2 MISSION shRNA shRNA Plasmid DNA
glutamate-rich 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.1-835s1c1
Sequence:CCGGGAAACCAGTTGCTTAAGTCTTCTCGAGAAGACTTAAGCAACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.1-321s1c1
Sequence:CCGGCTTTCTCAAAGTAACCAGGATCTCGAGATCCTGGTTACTTTGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.1-845s1c1
Sequence:CCGGGCTTAAGTCTTAGCCCTGAATCTCGAGATTCAGGGCTAAGACTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025744.2-1527s21c1
Sequence:CCGGTCACTTATTGAAGAGATATTGCTCGAGCAATATCTCTTCAATAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025744.2-314s21c1
Sequence:CCGGTCCGGCCTTTCTCAAAGTAACCTCGAGGTTACTTTGAGAAAGGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025744.2-1106s21c1
Sequence:CCGGTTCAAAGAAGAGCGAAGATAACTCGAGTTATCTTCGCTCTTCTTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025744.2-846s21c1
Sequence:CCGGTTAAGTCTTAGCCCTGAATTTCTCGAGAAATTCAGGGCTAAGACTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.2-1108s1c1
Sequence:CCGGCAAAGAAGAGCGAAGATAAAGCTCGAGCTTTATCTTCGCTCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.2-1474s1c1
Sequence:CCGGGTCAGATGATCCTAATCTATGCTCGAGCATAGATTAGGATCATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.2-1025s1c1
Sequence:CCGGGAGATTATCAAACAAGCTTTACTCGAGTAAAGCTTGTTTGATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025744.2-1469s21c1
Sequence:CCGGATTATGTCAGATGATCCTAATCTCGAGATTAGGATCATCTGACATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025744
VALIDATED
ERICH2 MISSION shRNA Lentiviral Transduction Particles
glutamate-rich 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.1-835s1c1
Sequence:CCGGGAAACCAGTTGCTTAAGTCTTCTCGAGAAGACTTAAGCAACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.1-321s1c1
Sequence:CCGGCTTTCTCAAAGTAACCAGGATCTCGAGATCCTGGTTACTTTGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.1-845s1c1
Sequence:CCGGGCTTAAGTCTTAGCCCTGAATCTCGAGATTCAGGGCTAAGACTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025744.2-1527s21c1
Sequence:CCGGTCACTTATTGAAGAGATATTGCTCGAGCAATATCTCTTCAATAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025744.2-314s21c1
Sequence:CCGGTCCGGCCTTTCTCAAAGTAACCTCGAGGTTACTTTGAGAAAGGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025744.2-1106s21c1
Sequence:CCGGTTCAAAGAAGAGCGAAGATAACTCGAGTTATCTTCGCTCTTCTTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025744.2-846s21c1
Sequence:CCGGTTAAGTCTTAGCCCTGAATTTCTCGAGAAATTCAGGGCTAAGACTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.2-1108s1c1
Sequence:CCGGCAAAGAAGAGCGAAGATAAAGCTCGAGCTTTATCTTCGCTCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.2-1474s1c1
Sequence:CCGGGTCAGATGATCCTAATCTATGCTCGAGCATAGATTAGGATCATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025744.2-1025s1c1
Sequence:CCGGGAGATTATCAAACAAGCTTTACTCGAGTAAAGCTTGTTTGATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025744.2-1469s21c1
Sequence:CCGGATTATGTCAGATGATCCTAATCTCGAGATTAGGATCATCTGACATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks