EMAIL THIS PAGE TO A FRIEND

ERLIN1

ER lipid raft associated 1

207 Gene Product Result for
Synonyms: C10orf69 Erlin-1 KE04 KEO4 SPFH1
UniProtKB ID: O75477, B0QZ42, Q53HV0
Gene ID:
Mouse(226144) ER lipid raft associated 1
Rat(293939) ER lipid raft associated 1
Zebrafish(541490) ER lipid raft associated 1
chicken(423670) ER lipid raft associated 1
dog(609141) ER lipid raft associated 1
cow(617074) ER lipid raft associated 1
domestic cat(101090647) ER lipid raft associated 1
domestic guinea pig(100726082) ER lipid raft associated 1
naked mole-rat(101718956) ER lipid raft associated 1
Goat(100861066) ER lipid raft associated 1
sheep(101121052) ER lipid raft associated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501274 Anti-ERLIN1 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA011252 Anti-ERLIN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100706 Anti-ERLIN1 antibody produced in rabbit affinity isolated antibody zebrafish, human, horse, bovine, canine, guinea pig, rabbit, pig, mouse, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006459 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU005661 MISSION® esiRNA esiRNA targeting mouse Erlin1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100626 Rosetta Predictions human pricing
NM_006459 Rosetta Predictions human pricing
NM_001106353 Rosetta Predictions rat pricing
NM_145502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322324 predicted 304
2 SASI_Hs02_00322325 predicted 520
3 SASI_Hs02_00322326 predicted 443
4 SASI_Hs02_00322327 predicted 425
5 SASI_Hs02_00322328 predicted 978
6 SASI_Hs02_00322329 predicted 973
7 SASI_Hs02_00322330 predicted 888
8 SASI_Hs02_00322331 predicted 373
9 SASI_Hs02_00322332 predicted 1236
10 SASI_Hs02_00322333 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208664 predicted 548
2 SASI_Hs01_00208665 predicted 766
3 SASI_Hs01_00208666 predicted 690
4 SASI_Hs01_00208667 predicted 666
5 SASI_Hs01_00208668 predicted 1224
6 SASI_Hs02_00341606 predicted 1220
7 SASI_Hs02_00341607 predicted 1126
8 SASI_Hs01_00208671 predicted 612
9 SASI_Hs01_00208672 predicted 1480
10 SASI_Hs01_00208673 predicted 596
11 SASI_Hs01_00208669 predicted 482
12 SASI_Hs01_00208670 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106353 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218138 predicted 737
2 SASI_Rn02_00218139 predicted 275
3 SASI_Rn02_00218140 predicted 965
4 SASI_Rn02_00218141 predicted 406
5 SASI_Rn02_00218142 predicted 251
6 SASI_Rn02_00218143 predicted 359
7 SASI_Rn02_00218144 predicted 590
8 SASI_Rn02_00218145 predicted 899
9 SASI_Rn02_00218146 predicted 1038
10 SASI_Rn02_00218147 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106388 predicted 576
2 SASI_Mm01_00106389 predicted 472
3 SASI_Mm01_00106390 predicted 822
4 SASI_Mm01_00106391 predicted 423
5 SASI_Mm01_00106392 predicted 652
6 SASI_Mm01_00106393 predicted 947
7 SASI_Mm01_00106394 predicted 312
8 SASI_Mm01_00106395 predicted 413
9 SASI_Mm01_00106396 predicted 409
10 SASI_Mm01_00106397 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006459
VALIDATED
ERLIN1 MISSION shRNA Bacterial Glycerol Stock
ER lipid raft associated 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006459.2-2141s1c1
Sequence:CCGGGCCCACATAGTGTGGAACAAACTCGAGTTTGTTCCACACTATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006459.2-792s1c1
Sequence:CCGGGCGAAAGCAGATGCTGAATATCTCGAGATATTCAGCATCTGCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006459.2-351s1c1
Sequence:CCGGGCAGATTATGACAAGACCTTACTCGAGTAAGGTCTTGTCATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006459.2-287s1c1
Sequence:CCGGCCGAATAGAAGTGGTTAATATCTCGAGATATTAACCACTTCTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006459.2-747s1c1
Sequence:CCGGCGCATTTCTGAAATCGAAGATCTCGAGATCTTCGATTTCAGAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006459.3-618s21c1
Sequence:CCGGCCGAATAGAAGTGGTTAATATCTCGAGATATTAACCACTTCTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006459.3-682s21c1
Sequence:CCGGGCAGATTATGACAAGACCTTACTCGAGTAAGGTCTTGTCATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006459.3-1123s21c1
Sequence:CCGGGCGAAAGCAGATGCTGAATATCTCGAGATATTCAGCATCTGCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006459.3-1078s21c1
Sequence:CCGGCGCATTTCTGAAATCGAAGATCTCGAGATCTTCGATTTCAGAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006459.3-2474s21c1
Sequence:CCGGGCCCACATAGTGTGGAACAAACTCGAGTTTGTTCCACACTATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006459
VALIDATED
ERLIN1 MISSION shRNA shRNA Plasmid DNA
ER lipid raft associated 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006459.2-2141s1c1
Sequence:CCGGGCCCACATAGTGTGGAACAAACTCGAGTTTGTTCCACACTATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006459.2-792s1c1
Sequence:CCGGGCGAAAGCAGATGCTGAATATCTCGAGATATTCAGCATCTGCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006459.2-351s1c1
Sequence:CCGGGCAGATTATGACAAGACCTTACTCGAGTAAGGTCTTGTCATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006459.2-287s1c1
Sequence:CCGGCCGAATAGAAGTGGTTAATATCTCGAGATATTAACCACTTCTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006459.2-747s1c1
Sequence:CCGGCGCATTTCTGAAATCGAAGATCTCGAGATCTTCGATTTCAGAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006459.3-618s21c1
Sequence:CCGGCCGAATAGAAGTGGTTAATATCTCGAGATATTAACCACTTCTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006459.3-682s21c1
Sequence:CCGGGCAGATTATGACAAGACCTTACTCGAGTAAGGTCTTGTCATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006459.3-1123s21c1
Sequence:CCGGGCGAAAGCAGATGCTGAATATCTCGAGATATTCAGCATCTGCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006459.3-1078s21c1
Sequence:CCGGCGCATTTCTGAAATCGAAGATCTCGAGATCTTCGATTTCAGAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006459.3-2474s21c1
Sequence:CCGGGCCCACATAGTGTGGAACAAACTCGAGTTTGTTCCACACTATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006459
VALIDATED
ERLIN1 MISSION shRNA Lentiviral Transduction Particles
ER lipid raft associated 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006459.2-2141s1c1
Sequence:CCGGGCCCACATAGTGTGGAACAAACTCGAGTTTGTTCCACACTATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006459.2-792s1c1
Sequence:CCGGGCGAAAGCAGATGCTGAATATCTCGAGATATTCAGCATCTGCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006459.2-351s1c1
Sequence:CCGGGCAGATTATGACAAGACCTTACTCGAGTAAGGTCTTGTCATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006459.2-287s1c1
Sequence:CCGGCCGAATAGAAGTGGTTAATATCTCGAGATATTAACCACTTCTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006459.2-747s1c1
Sequence:CCGGCGCATTTCTGAAATCGAAGATCTCGAGATCTTCGATTTCAGAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006459.3-618s21c1
Sequence:CCGGCCGAATAGAAGTGGTTAATATCTCGAGATATTAACCACTTCTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006459.3-682s21c1
Sequence:CCGGGCAGATTATGACAAGACCTTACTCGAGTAAGGTCTTGTCATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006459.3-1123s21c1
Sequence:CCGGGCGAAAGCAGATGCTGAATATCTCGAGATATTCAGCATCTGCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006459.3-1078s21c1
Sequence:CCGGCGCATTTCTGAAATCGAAGATCTCGAGATCTTCGATTTCAGAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006459.3-2474s21c1
Sequence:CCGGGCCCACATAGTGTGGAACAAACTCGAGTTTGTTCCACACTATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145502
VALIDATED
ERLIN1 MISSION shRNA Bacterial Glycerol Stock
ER lipid raft associated 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145502.2-2711s1c1
Sequence:CCGGGCCTTATAGTATAGAGGCATTCTCGAGAATGCCTCTATACTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145502.2-496s1c1
Sequence:CCGGGCAGACTACGACAAGACTTTACTCGAGTAAAGTCTTGTCGTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145502.2-431s1c1
Sequence:CCGGACCGAATAGAAGTGGTTAATACTCGAGTATTAACCACTTCTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145502.2-1017s1c1
Sequence:CCGGGCTCAAGAAATACCAGGCCATCTCGAGATGGCCTGGTATTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145502.2-823s1c1
Sequence:CCGGGCAGAGAAGATTGCACAAGTACTCGAGTACTTGTGCAATCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145502.2-2711s21c1
Sequence:CCGGGCCTTATAGTATAGAGGCATTCTCGAGAATGCCTCTATACTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145502.2-431s21c1
Sequence:CCGGACCGAATAGAAGTGGTTAATACTCGAGTATTAACCACTTCTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145502.2-496s21c1
Sequence:CCGGGCAGACTACGACAAGACTTTACTCGAGTAAAGTCTTGTCGTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145502.2-823s21c1
Sequence:CCGGGCAGAGAAGATTGCACAAGTACTCGAGTACTTGTGCAATCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145502
VALIDATED
ERLIN1 MISSION shRNA shRNA Plasmid DNA
ER lipid raft associated 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145502.2-2711s1c1
Sequence:CCGGGCCTTATAGTATAGAGGCATTCTCGAGAATGCCTCTATACTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145502.2-496s1c1
Sequence:CCGGGCAGACTACGACAAGACTTTACTCGAGTAAAGTCTTGTCGTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145502.2-431s1c1
Sequence:CCGGACCGAATAGAAGTGGTTAATACTCGAGTATTAACCACTTCTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145502.2-1017s1c1
Sequence:CCGGGCTCAAGAAATACCAGGCCATCTCGAGATGGCCTGGTATTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145502.2-823s1c1
Sequence:CCGGGCAGAGAAGATTGCACAAGTACTCGAGTACTTGTGCAATCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145502.2-2711s21c1
Sequence:CCGGGCCTTATAGTATAGAGGCATTCTCGAGAATGCCTCTATACTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145502.2-431s21c1
Sequence:CCGGACCGAATAGAAGTGGTTAATACTCGAGTATTAACCACTTCTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145502.2-496s21c1
Sequence:CCGGGCAGACTACGACAAGACTTTACTCGAGTAAAGTCTTGTCGTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145502.2-823s21c1
Sequence:CCGGGCAGAGAAGATTGCACAAGTACTCGAGTACTTGTGCAATCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145502
VALIDATED
ERLIN1 MISSION shRNA Lentiviral Transduction Particles
ER lipid raft associated 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145502.2-2711s1c1
Sequence:CCGGGCCTTATAGTATAGAGGCATTCTCGAGAATGCCTCTATACTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145502.2-496s1c1
Sequence:CCGGGCAGACTACGACAAGACTTTACTCGAGTAAAGTCTTGTCGTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145502.2-431s1c1
Sequence:CCGGACCGAATAGAAGTGGTTAATACTCGAGTATTAACCACTTCTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145502.2-1017s1c1
Sequence:CCGGGCTCAAGAAATACCAGGCCATCTCGAGATGGCCTGGTATTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145502.2-823s1c1
Sequence:CCGGGCAGAGAAGATTGCACAAGTACTCGAGTACTTGTGCAATCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145502.2-2711s21c1
Sequence:CCGGGCCTTATAGTATAGAGGCATTCTCGAGAATGCCTCTATACTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145502.2-431s21c1
Sequence:CCGGACCGAATAGAAGTGGTTAATACTCGAGTATTAACCACTTCTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145502.2-496s21c1
Sequence:CCGGGCAGACTACGACAAGACTTTACTCGAGTAAAGTCTTGTCGTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145502.2-823s21c1
Sequence:CCGGGCAGAGAAGATTGCACAAGTACTCGAGTACTTGTGCAATCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks