EMAIL THIS PAGE TO A FRIEND

ERLIN2

ER lipid raft associated 2

200 Gene Product Result for
Synonyms: C8orf2 Erlin-2 NET32 SPFH2 SPG18
Gene ID:
Human(11160) Summary: This gene encodes a member of the SPFH domain-containing family of lipid raft-associated proteins. The encoded protein is localized to lipid rafts of the endoplasmic reticulum and plays a critical role in inositol 1,4,5-trisphosphate (IP3) signaling by mediating ER-associated degradation of activated IP3 receptors. Mutations in this gene are a cause of spastic paraplegia-18 (SPG18). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Mouse(244373) ER lipid raft associated 2
Rat(290823) ER lipid raft associated 2
sheep(101110479) ER lipid raft associated 2
Domestic Rabbit(100354383) ER lipid raft associated 2
naked mole-rat(101714906) ER lipid raft associated 2
domestic guinea pig(100734771) ER lipid raft associated 2
Zebrafish(100151163) ER lipid raft associated 2
chicken(426769) ER lipid raft associated 2
cow(616278) ER lipid raft associated 2
domestic cat(101089349) ER lipid raft associated 2
dog(607518) ER lipid raft associated 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007175 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003790 Rosetta Predictions human pricing
NM_001003791 Rosetta Predictions human pricing
NM_007175 Rosetta Predictions human pricing
NM_001106088 Rosetta Predictions rat pricing
NM_153592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147582 predicted 588
2 SASI_Hs01_00147583 predicted 599
3 SASI_Hs01_00147584 predicted 572
4 SASI_Hs01_00147585 predicted 571
5 SASI_Hs01_00147586 predicted 630
6 SASI_Hs01_00147587 predicted 587
7 SASI_Hs02_00304377 predicted 756
8 SASI_Hs01_00147588 predicted 652
9 SASI_Hs01_00147589 predicted 734
10 SASI_Hs01_00147590 predicted 565
11 SASI_Hs01_00147591 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227519 predicted 354
2 SASI_Hs01_00227520 predicted 373
3 SASI_Hs01_00227521 predicted 346
4 SASI_Hs01_00227522 predicted 339
5 SASI_Hs01_00227523 predicted 405
6 SASI_Hs01_00227524 predicted 358
7 SASI_Hs02_00304378 predicted 526
8 SASI_Hs01_00227525 predicted 428
9 SASI_Hs01_00227526 predicted 502
10 SASI_Hs01_00227527 predicted 339
11 SASI_Hs01_00227528 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343118 predicted 268
2 SASI_Hs02_00343119 predicted 265
3 SASI_Hs02_00343120 predicted 243
4 SASI_Hs02_00343121 predicted 223
5 SASI_Hs02_00343122 predicted 265
6 SASI_Hs02_00343123 predicted 221
7 SASI_Hs02_00343124 predicted 262
8 SASI_Hs02_00343125 predicted 307
9 SASI_Hs02_00343126 predicted 242
10 SASI_Hs02_00343127 predicted 244
11 SASI_Hs01_00149075 predicted 610
12 SASI_Hs01_00149076 predicted 317
13 SASI_Hs01_00149077 predicted 945
14 SASI_Hs01_00149078 predicted 1029
15 SASI_Hs01_00149079 predicted 329
16 SASI_Hs01_00149080 predicted 1104
17 SASI_Hs01_00149081 predicted 476
18 SASI_Hs01_00149082 predicted 557
19 SASI_Hs01_00149083 predicted 699
20 SASI_Hs01_00149084 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215512 predicted 1147
2 SASI_Rn02_00215513 predicted 872
3 SASI_Rn02_00215514 predicted 457
4 SASI_Rn02_00215515 predicted 1054
5 SASI_Rn02_00215516 predicted 838
6 SASI_Rn02_00215517 predicted 922
7 SASI_Rn02_00215518 predicted 840
8 SASI_Rn02_00215519 predicted 910
9 SASI_Rn02_00215520 predicted 430
10 SASI_Rn02_00215521 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121648 predicted 309
2 SASI_Mm01_00121649 predicted 350
3 SASI_Mm01_00121651 predicted 473
4 SASI_Mm01_00121652 predicted 1123
5 SASI_Mm01_00121653 predicted 1084
6 SASI_Mm01_00121654 predicted 1111
7 SASI_Mm01_00121655 predicted 1170
8 SASI_Mm01_00121656 predicted 243
9 SASI_Mm01_00121657 predicted 938
10 SASI_Mm02_00343426 predicted 729
11 SASI_Mm01_00121650 predicted 692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007175
VALIDATED
ERLIN2 MISSION shRNA Bacterial Glycerol Stock
ER lipid raft associated 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007175.6-1044s21c1
Sequence:CCGGGCAGTGTGAGCAAGCAGTTTGCTCGAGCAAACTGCTTGCTCACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007175.6-363s21c1
Sequence:CCGGTGATCTACTTTGACAGAATTGCTCGAGCAATTCTGTCAAAGTAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007175.4-248s1c1
Sequence:CCGGCCATCTCATGCTCCCTTTCATCTCGAGATGAAAGGGAGCATGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007175.4-171s1c1
Sequence:CCGGCACAAGATAGAAGAGGGACATCTCGAGATGTCCCTCTTCTATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007175.4-395s1c1
Sequence:CCGGCGCAGTGTATGATATAGTGAACTCGAGTTCACTATATCATACACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007175.4-909s1c1
Sequence:CCGGGAAGCCAATAAGCTGAAGCTACTCGAGTAGCTTCAGCTTATTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007175.4-1062s1c1
Sequence:CCGGGACAAGCTAAGCTTTGGCTTACTCGAGTAAGCCAAAGCTTAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007175.4-638s1c1
Sequence:CCGGCCGCAGAAACTACGAGTTGATCTCGAGATCAACTCGTAGTTTCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007175.4-299s1c1
Sequence:CCGGCCAGACAGATGAGGTGAAGAACTCGAGTTCTTCACCTCATCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007175
VALIDATED
ERLIN2 MISSION shRNA shRNA Plasmid DNA
ER lipid raft associated 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007175.6-1044s21c1
Sequence:CCGGGCAGTGTGAGCAAGCAGTTTGCTCGAGCAAACTGCTTGCTCACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007175.6-363s21c1
Sequence:CCGGTGATCTACTTTGACAGAATTGCTCGAGCAATTCTGTCAAAGTAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007175.4-248s1c1
Sequence:CCGGCCATCTCATGCTCCCTTTCATCTCGAGATGAAAGGGAGCATGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007175.4-171s1c1
Sequence:CCGGCACAAGATAGAAGAGGGACATCTCGAGATGTCCCTCTTCTATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007175.4-395s1c1
Sequence:CCGGCGCAGTGTATGATATAGTGAACTCGAGTTCACTATATCATACACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007175.4-909s1c1
Sequence:CCGGGAAGCCAATAAGCTGAAGCTACTCGAGTAGCTTCAGCTTATTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007175.4-1062s1c1
Sequence:CCGGGACAAGCTAAGCTTTGGCTTACTCGAGTAAGCCAAAGCTTAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007175.4-638s1c1
Sequence:CCGGCCGCAGAAACTACGAGTTGATCTCGAGATCAACTCGTAGTTTCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007175.4-299s1c1
Sequence:CCGGCCAGACAGATGAGGTGAAGAACTCGAGTTCTTCACCTCATCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007175
VALIDATED
ERLIN2 MISSION shRNA Lentiviral Transduction Particles
ER lipid raft associated 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007175.6-1044s21c1
Sequence:CCGGGCAGTGTGAGCAAGCAGTTTGCTCGAGCAAACTGCTTGCTCACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007175.6-363s21c1
Sequence:CCGGTGATCTACTTTGACAGAATTGCTCGAGCAATTCTGTCAAAGTAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007175.4-248s1c1
Sequence:CCGGCCATCTCATGCTCCCTTTCATCTCGAGATGAAAGGGAGCATGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007175.4-171s1c1
Sequence:CCGGCACAAGATAGAAGAGGGACATCTCGAGATGTCCCTCTTCTATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007175.4-395s1c1
Sequence:CCGGCGCAGTGTATGATATAGTGAACTCGAGTTCACTATATCATACACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007175.4-909s1c1
Sequence:CCGGGAAGCCAATAAGCTGAAGCTACTCGAGTAGCTTCAGCTTATTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007175.4-1062s1c1
Sequence:CCGGGACAAGCTAAGCTTTGGCTTACTCGAGTAAGCCAAAGCTTAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007175.4-638s1c1
Sequence:CCGGCCGCAGAAACTACGAGTTGATCTCGAGATCAACTCGTAGTTTCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007175.4-299s1c1
Sequence:CCGGCCAGACAGATGAGGTGAAGAACTCGAGTTCTTCACCTCATCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153592
VALIDATED
ERLIN2 MISSION shRNA Bacterial Glycerol Stock
ER lipid raft associated 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153592.1-2867s1c1
Sequence:CCGGCCCTTTAATGTCACTTCTTTACTCGAGTAAAGAAGTGACATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153592.1-222s1c1
Sequence:CCGGCCCGTTCATCACATCCTATAACTCGAGTTATAGGATGTGATGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153592.1-579s1c1
Sequence:CCGGGCCCAATATACCTGAGGCAATCTCGAGATTGCCTCAGGTATATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153592.1-567s1c1
Sequence:CCGGGCGAGTGACAAAGCCCAATATCTCGAGATATTGGGCTTTGTCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153592.1-882s1c1
Sequence:CCGGGCTCAAGCTGACTCCAGAATACTCGAGTATTCTGGAGTCAGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153592
VALIDATED
ERLIN2 MISSION shRNA shRNA Plasmid DNA
ER lipid raft associated 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153592.1-2867s1c1
Sequence:CCGGCCCTTTAATGTCACTTCTTTACTCGAGTAAAGAAGTGACATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153592.1-222s1c1
Sequence:CCGGCCCGTTCATCACATCCTATAACTCGAGTTATAGGATGTGATGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153592.1-579s1c1
Sequence:CCGGGCCCAATATACCTGAGGCAATCTCGAGATTGCCTCAGGTATATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153592.1-567s1c1
Sequence:CCGGGCGAGTGACAAAGCCCAATATCTCGAGATATTGGGCTTTGTCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153592.1-882s1c1
Sequence:CCGGGCTCAAGCTGACTCCAGAATACTCGAGTATTCTGGAGTCAGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153592
VALIDATED
ERLIN2 MISSION shRNA Lentiviral Transduction Particles
ER lipid raft associated 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153592.1-2867s1c1
Sequence:CCGGCCCTTTAATGTCACTTCTTTACTCGAGTAAAGAAGTGACATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153592.1-222s1c1
Sequence:CCGGCCCGTTCATCACATCCTATAACTCGAGTTATAGGATGTGATGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153592.1-579s1c1
Sequence:CCGGGCCCAATATACCTGAGGCAATCTCGAGATTGCCTCAGGTATATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153592.1-567s1c1
Sequence:CCGGGCGAGTGACAAAGCCCAATATCTCGAGATATTGGGCTTTGTCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153592.1-882s1c1
Sequence:CCGGGCTCAAGCTGACTCCAGAATACTCGAGTATTCTGGAGTCAGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks