EMAIL THIS PAGE TO A FRIEND

ERMAP

erythroblast membrane-associated protein (Scianna blood group)

106 Gene Product Result for
Synonyms: PRO2801 RD SC
Gene ID:
Human(114625) Summary: The protein encoded by this gene is a cell surface transmembrane protein that may act as an erythroid cell receptor, possibly as a mediator of cell adhesion. Polymorphisms in this gene are responsible for the Scianna/Radin blood group system. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(27028) erythroblast membrane-associated protein
Rat(298485) erythroblast membrane-associated protein
dog(482439) erythroblast membrane-associated protein (Scianna blood group)
domestic cat(101095031) erythroblast membrane-associated protein (Scianna blood group)
cow(514218) erythroblast membrane-associated protein (Scianna blood group)
Horse(100067234) erythroblast membrane-associated protein (Scianna blood group)
domestic guinea pig(100715276) erythroblast membrane-associated protein (Scianna blood group)
naked mole-rat(101697500) erythroblast membrane-associated protein (Scianna blood group)
sheep(101103113) erythroblast membrane-associated protein (Scianna blood group)
Domestic Rabbit(100354196) erythroblast membrane-associated protein (Scianna blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018538 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018538 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018538 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013848 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013848 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013848 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017922 Rosetta Predictions human pricing
NM_018538 Rosetta Predictions human pricing
XM_001073566 Rosetta Predictions rat pricing
XM_233453 Rosetta Predictions rat pricing
NM_013848 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081254 predicted 1176
2 SASI_Hs01_00081255 predicted 913
3 SASI_Hs01_00081256 predicted 883
4 SASI_Hs01_00081257 predicted 1030
5 SASI_Hs01_00081258 predicted 1369
6 SASI_Hs01_00081259 predicted 1009
7 SASI_Hs01_00081261 predicted 532
8 SASI_Hs01_00081262 predicted 1160
9 SASI_Hs02_00306806 predicted 499
10 SASI_Hs01_00081263 predicted 568
11 SASI_Hs01_00081260 predicted 1515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116440 predicted 1069
2 SASI_Hs01_00116441 predicted 813
3 SASI_Hs01_00116442 predicted 786
4 SASI_Hs01_00116443 predicted 933
5 SASI_Hs01_00116444 predicted 1264
6 SASI_Hs01_00116445 predicted 903
7 SASI_Hs01_00116447 predicted 426
8 SASI_Hs01_00116448 predicted 1063
9 SASI_Hs02_00352101 predicted 389
10 SASI_Hs01_00116449 predicted 466
11 SASI_Hs01_00116446 predicted 1412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073566 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343190 predicted 1671
2 SASI_Rn02_00343191 predicted 493
3 SASI_Rn02_00343192 predicted 1205
4 SASI_Rn02_00343193 predicted 562
5 SASI_Rn02_00343194 predicted 707
6 SASI_Rn02_00343195 predicted 337
7 SASI_Rn02_00343196 predicted 1345
8 SASI_Rn02_00343197 predicted 478
9 SASI_Rn02_00343198 predicted 721
10 SASI_Rn02_00343199 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387794 predicted 1664
2 SASI_Rn02_00387795 predicted 495
3 SASI_Rn02_00387796 predicted 1199
4 SASI_Rn02_00387797 predicted 561
5 SASI_Rn02_00387798 predicted 707
6 SASI_Rn02_00387799 predicted 339
7 SASI_Rn02_00387800 predicted 1349
8 SASI_Rn02_00387801 predicted 470
9 SASI_Rn02_00387802 predicted 724
10 SASI_Rn02_00387803 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169362 predicted 1918
2 SASI_Mm01_00169363 predicted 1809
3 SASI_Mm01_00169364 predicted 604
4 SASI_Mm01_00169365 predicted 1683
5 SASI_Mm02_00322853 predicted 270
6 SASI_Mm02_00322854 predicted 1675
7 SASI_Mm01_00169366 predicted 1957
8 SASI_Mm01_00169367 predicted 451
9 SASI_Mm01_00169368 predicted 1469
10 SASI_Mm01_00169369 predicted 1973
11 SASI_Mm01_00169370 predicted 229
12 SASI_Mm01_00169371 predicted 1416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018538
ERMAP MISSION shRNA Bacterial Glycerol Stock
erythroblast membrane-associated protein (Scianna blood group)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-665s1c1
Sequence:CCGGCTTCTCATCATGGTGTGCCTTCTCGAGAAGGCACACCATGATGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-1477s1c1
Sequence:CCGGCCTCAAGGTGAACTCTTCTTTCTCGAGAAAGAAGAGTTCACCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-1074s1c1
Sequence:CCGGCCAAATGGATTCTTGGAGTATCTCGAGATACTCCAAGAATCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-1522s1c1
Sequence:CCGGGAAGGATATAATCCTGTCCTTCTCGAGAAGGACAGGATTATATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-694s1c1
Sequence:CCGGCTGGAAGCAAAGAAGAGCAAACTCGAGTTTGCTCTTCTTTGCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-428s1c1
Sequence:CCGGGAAGATCTGATGCCGGAATATCTCGAGATATTCCGGCATCAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-1513s1c1
Sequence:CCGGCCCAGAGCTGAAGGATATAATCTCGAGATTATATCCTTCAGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-812s1c1
Sequence:CCGGCGGAGTGAACTGAAGTTGAAACTCGAGTTTCAACTTCAGTTCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-995s1c1
Sequence:CCGGGATTTCGTTGTCAGCATCCTACTCGAGTAGGATGCTGACAACGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-1343s1c1
Sequence:CCGGCCTTTCTTTGAACCTTGCCTTCTCGAGAAGGCAAGGTTCAAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018538
ERMAP MISSION shRNA shRNA Plasmid DNA
erythroblast membrane-associated protein (Scianna blood group)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-665s1c1
Sequence:CCGGCTTCTCATCATGGTGTGCCTTCTCGAGAAGGCACACCATGATGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-1477s1c1
Sequence:CCGGCCTCAAGGTGAACTCTTCTTTCTCGAGAAAGAAGAGTTCACCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-1074s1c1
Sequence:CCGGCCAAATGGATTCTTGGAGTATCTCGAGATACTCCAAGAATCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-1522s1c1
Sequence:CCGGGAAGGATATAATCCTGTCCTTCTCGAGAAGGACAGGATTATATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-694s1c1
Sequence:CCGGCTGGAAGCAAAGAAGAGCAAACTCGAGTTTGCTCTTCTTTGCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-428s1c1
Sequence:CCGGGAAGATCTGATGCCGGAATATCTCGAGATATTCCGGCATCAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-1513s1c1
Sequence:CCGGCCCAGAGCTGAAGGATATAATCTCGAGATTATATCCTTCAGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-812s1c1
Sequence:CCGGCGGAGTGAACTGAAGTTGAAACTCGAGTTTCAACTTCAGTTCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-995s1c1
Sequence:CCGGGATTTCGTTGTCAGCATCCTACTCGAGTAGGATGCTGACAACGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-1343s1c1
Sequence:CCGGCCTTTCTTTGAACCTTGCCTTCTCGAGAAGGCAAGGTTCAAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018538
ERMAP MISSION shRNA Lentiviral Transduction Particles
erythroblast membrane-associated protein (Scianna blood group)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-665s1c1
Sequence:CCGGCTTCTCATCATGGTGTGCCTTCTCGAGAAGGCACACCATGATGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-1477s1c1
Sequence:CCGGCCTCAAGGTGAACTCTTCTTTCTCGAGAAAGAAGAGTTCACCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-1074s1c1
Sequence:CCGGCCAAATGGATTCTTGGAGTATCTCGAGATACTCCAAGAATCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-1522s1c1
Sequence:CCGGGAAGGATATAATCCTGTCCTTCTCGAGAAGGACAGGATTATATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-694s1c1
Sequence:CCGGCTGGAAGCAAAGAAGAGCAAACTCGAGTTTGCTCTTCTTTGCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-428s1c1
Sequence:CCGGGAAGATCTGATGCCGGAATATCTCGAGATATTCCGGCATCAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-1513s1c1
Sequence:CCGGCCCAGAGCTGAAGGATATAATCTCGAGATTATATCCTTCAGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018538.2-812s1c1
Sequence:CCGGCGGAGTGAACTGAAGTTGAAACTCGAGTTTCAACTTCAGTTCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-995s1c1
Sequence:CCGGGATTTCGTTGTCAGCATCCTACTCGAGTAGGATGCTGACAACGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018538.2-1343s1c1
Sequence:CCGGCCTTTCTTTGAACCTTGCCTTCTCGAGAAGGCAAGGTTCAAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013848
ERMAP MISSION shRNA Bacterial Glycerol Stock
erythroblast membrane-associated protein (Scianna blood group)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013848.1-3464s1c1
Sequence:CCGGCCTCCCATTGATGACCAACTACTCGAGTAGTTGGTCATCAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013848.1-1179s1c1
Sequence:CCGGCCGGAGTGAACTGAAGTTGAACTCGAGTTCAACTTCAGTTCACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013848.1-1711s1c1
Sequence:CCGGCCTTTCTTTGAACCTTGTCTTCTCGAGAAGACAAGGTTCAAAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013848.1-241s1c1
Sequence:CCGGTCACGGAAGATGTCAGTTCATCTCGAGATGAACTGACATCTTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013848.1-1656s1c1
Sequence:CCGGGACTGATAAGTCCCACATCTTCTCGAGAAGATGTGGGACTTATCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013848
ERMAP MISSION shRNA shRNA Plasmid DNA
erythroblast membrane-associated protein (Scianna blood group)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013848.1-3464s1c1
Sequence:CCGGCCTCCCATTGATGACCAACTACTCGAGTAGTTGGTCATCAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013848.1-1179s1c1
Sequence:CCGGCCGGAGTGAACTGAAGTTGAACTCGAGTTCAACTTCAGTTCACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013848.1-1711s1c1
Sequence:CCGGCCTTTCTTTGAACCTTGTCTTCTCGAGAAGACAAGGTTCAAAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013848.1-241s1c1
Sequence:CCGGTCACGGAAGATGTCAGTTCATCTCGAGATGAACTGACATCTTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013848.1-1656s1c1
Sequence:CCGGGACTGATAAGTCCCACATCTTCTCGAGAAGATGTGGGACTTATCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013848
ERMAP MISSION shRNA Lentiviral Transduction Particles
erythroblast membrane-associated protein (Scianna blood group)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013848.1-3464s1c1
Sequence:CCGGCCTCCCATTGATGACCAACTACTCGAGTAGTTGGTCATCAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013848.1-1179s1c1
Sequence:CCGGCCGGAGTGAACTGAAGTTGAACTCGAGTTCAACTTCAGTTCACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013848.1-1711s1c1
Sequence:CCGGCCTTTCTTTGAACCTTGTCTTCTCGAGAAGACAAGGTTCAAAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013848.1-241s1c1
Sequence:CCGGTCACGGAAGATGTCAGTTCATCTCGAGATGAACTGACATCTTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013848.1-1656s1c1
Sequence:CCGGGACTGATAAGTCCCACATCTTCTCGAGAAGATGTGGGACTTATCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks