EMAIL THIS PAGE TO A FRIEND

ERMARD

ER membrane-associated RNA degradation

43 Gene Product Result for
Synonyms: C6orf70 dJ266L20.3
Gene ID:
Mouse(381062) ER membrane associated RNA degradation
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198646 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198646 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198646 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018341 Rosetta Predictions human pricing
NM_001034891 Rosetta Predictions mouse pricing
NM_001039552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351792 predicted 618
2 SASI_Hs01_00107531 predicted 406
3 SASI_Hs01_00107532 predicted 702
4 SASI_Hs01_00107533 predicted 1127
5 SASI_Hs01_00107534 predicted 593
6 SASI_Hs01_00107535 predicted 1080
7 SASI_Hs01_00107536 predicted 392
8 SASI_Hs01_00107537 predicted 575
9 SASI_Hs01_00107538 predicted 1844
10 SASI_Hs01_00107539 predicted 802
11 SASI_Hs01_00107530 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115615 predicted 1061
2 SASI_Mm01_00115616 predicted 1101
3 SASI_Mm02_00289165 predicted 951
4 SASI_Mm01_00115617 predicted 1091
5 SASI_Mm01_00115618 predicted 750
6 SASI_Mm01_00115619 predicted 672
7 SASI_Mm01_00115620 predicted 799
8 SASI_Mm01_00115622 predicted 480
9 SASI_Mm01_00115623 predicted 1006
10 SASI_Mm01_00115624 predicted 678
11 SASI_Mm01_00115621 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195917 predicted 1989
2 SASI_Mm01_00195918 predicted 2041
3 SASI_Mm02_00290131 predicted 1877
4 SASI_Mm01_00195919 predicted 2023
5 SASI_Mm01_00195920 predicted 1678
6 SASI_Mm01_00195921 predicted 1600
7 SASI_Mm01_00195922 predicted 1732
8 SASI_Mm01_00195924 predicted 1415
9 SASI_Mm01_00195925 predicted 1933
10 SASI_Mm01_00195926 predicted 1607
11 SASI_Mm01_00195923 predicted 1989
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018341
VALIDATED
ERMARD MISSION shRNA Bacterial Glycerol Stock
ER membrane-associated RNA degradation
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018341.1-952s1c1
Sequence:CCGGGCCACACTTAACAGATGTCCACTCGAGTGGACATCTGTTAAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018341.1-367s1c1
Sequence:CCGGGATGCCTTGGAAAGTCTACAACTCGAGTTGTAGACTTTCCAAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018341.1-904s1c1
Sequence:CCGGGCCATATTGTTGCTGACACAACTCGAGTTGTGTCAGCAACAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018341.1-1000s1c1
Sequence:CCGGGCTCTTTATACCACCTTTGATCTCGAGATCAAAGGTGGTATAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018341.1-873s1c1
Sequence:CCGGCAAGTTCAAGTCACACAGGTTCTCGAGAACCTGTGTGACTTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018341.1-1274s1c1
Sequence:CCGGCAGCCGTAGAATTGTTGATTACTCGAGTAATCAACAATTCTACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018341.1-380s1c1
Sequence:CCGGGTCTACAATCTCCTGCTATTTCTCGAGAAATAGCAGGAGATTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-435s21c1
Sequence:CCGGACGAGCCTTGGGTGATGTATTCTCGAGAATACATCACCCAAGGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-715s21c1
Sequence:CCGGACATTGGCACATCGCTCTTTCCTCGAGGAAAGAGCGATGTGCCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-1952s21c1
Sequence:CCAGAGTGGAATGAAACTATCAATCCTCGAGGATTGATAGTTTCATTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-1411s21c1
Sequence:CCGGACTCGGCAAGCCGTCAGATTACTCGAGTAATCTGACGGCTTGCCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-1799s21c1
Sequence:CCGGGCCTGATACTGTTACTCATTGCTCGAGCAATGAGTAACAGTATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018341
VALIDATED
ERMARD MISSION shRNA shRNA Plasmid DNA
ER membrane-associated RNA degradation
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018341.1-952s1c1
Sequence:CCGGGCCACACTTAACAGATGTCCACTCGAGTGGACATCTGTTAAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018341.1-367s1c1
Sequence:CCGGGATGCCTTGGAAAGTCTACAACTCGAGTTGTAGACTTTCCAAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018341.1-904s1c1
Sequence:CCGGGCCATATTGTTGCTGACACAACTCGAGTTGTGTCAGCAACAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018341.1-1000s1c1
Sequence:CCGGGCTCTTTATACCACCTTTGATCTCGAGATCAAAGGTGGTATAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018341.1-873s1c1
Sequence:CCGGCAAGTTCAAGTCACACAGGTTCTCGAGAACCTGTGTGACTTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018341.1-1274s1c1
Sequence:CCGGCAGCCGTAGAATTGTTGATTACTCGAGTAATCAACAATTCTACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018341.1-380s1c1
Sequence:CCGGGTCTACAATCTCCTGCTATTTCTCGAGAAATAGCAGGAGATTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-435s21c1
Sequence:CCGGACGAGCCTTGGGTGATGTATTCTCGAGAATACATCACCCAAGGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-715s21c1
Sequence:CCGGACATTGGCACATCGCTCTTTCCTCGAGGAAAGAGCGATGTGCCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-1952s21c1
Sequence:CCAGAGTGGAATGAAACTATCAATCCTCGAGGATTGATAGTTTCATTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-1411s21c1
Sequence:CCGGACTCGGCAAGCCGTCAGATTACTCGAGTAATCTGACGGCTTGCCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-1799s21c1
Sequence:CCGGGCCTGATACTGTTACTCATTGCTCGAGCAATGAGTAACAGTATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018341
VALIDATED
ERMARD MISSION shRNA Lentiviral Transduction Particles
ER membrane-associated RNA degradation
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018341.1-952s1c1
Sequence:CCGGGCCACACTTAACAGATGTCCACTCGAGTGGACATCTGTTAAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018341.1-367s1c1
Sequence:CCGGGATGCCTTGGAAAGTCTACAACTCGAGTTGTAGACTTTCCAAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018341.1-904s1c1
Sequence:CCGGGCCATATTGTTGCTGACACAACTCGAGTTGTGTCAGCAACAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018341.1-1000s1c1
Sequence:CCGGGCTCTTTATACCACCTTTGATCTCGAGATCAAAGGTGGTATAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018341.1-873s1c1
Sequence:CCGGCAAGTTCAAGTCACACAGGTTCTCGAGAACCTGTGTGACTTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018341.1-1274s1c1
Sequence:CCGGCAGCCGTAGAATTGTTGATTACTCGAGTAATCAACAATTCTACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018341.1-380s1c1
Sequence:CCGGGTCTACAATCTCCTGCTATTTCTCGAGAAATAGCAGGAGATTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-435s21c1
Sequence:CCGGACGAGCCTTGGGTGATGTATTCTCGAGAATACATCACCCAAGGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-715s21c1
Sequence:CCGGACATTGGCACATCGCTCTTTCCTCGAGGAAAGAGCGATGTGCCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-1952s21c1
Sequence:CCAGAGTGGAATGAAACTATCAATCCTCGAGGATTGATAGTTTCATTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-1411s21c1
Sequence:CCGGACTCGGCAAGCCGTCAGATTACTCGAGTAATCTGACGGCTTGCCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018341.1-1799s21c1
Sequence:CCGGGCCTGATACTGTTACTCATTGCTCGAGCAATGAGTAACAGTATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198646
ERMARD MISSION shRNA Bacterial Glycerol Stock
ER membrane-associated RNA degradation
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198646.1-307s1c1
Sequence:CCGGGTGGACAACTTATCCAGAGTTCTCGAGAACTCTGGATAAGTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198646.1-171s1c1
Sequence:CCGGGATATGAAGAATTAGGGCGAACTCGAGTTCGCCCTAATTCTTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198646.1-67s1c1
Sequence:CCGGCTTGATTTGTAACCTTGGGTTCTCGAGAACCCAAGGTTACAAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198646.1-1943s1c1
Sequence:CCGGCGTTTGATGAAATACTGGCAACTCGAGTTGCCAGTATTTCATCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198646.1-272s1c1
Sequence:CCGGGCTCAGTTTGAAATTCAGTATCTCGAGATACTGAATTTCAAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198646.1-938s1c1
Sequence:CCGGGCACTCACTTTGTAAGTAGTACTCGAGTACTACTTACAAAGTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198646.1-323s1c1
Sequence:CCGGGAGTTGTTTCTTGAGATACTTCTCGAGAAGTATCTCAAGAAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198646.1-152s1c1
Sequence:CCGGGCAATTACTGACCGTGTGAGACTCGAGTCTCACACGGTCAGTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198646.1-53s1c1
Sequence:CCGGCCTTTAGTGCATGACTTGATTCTCGAGAATCAAGTCATGCACTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198646
ERMARD MISSION shRNA shRNA Plasmid DNA
ER membrane-associated RNA degradation
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198646.1-307s1c1
Sequence:CCGGGTGGACAACTTATCCAGAGTTCTCGAGAACTCTGGATAAGTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198646.1-171s1c1
Sequence:CCGGGATATGAAGAATTAGGGCGAACTCGAGTTCGCCCTAATTCTTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198646.1-67s1c1
Sequence:CCGGCTTGATTTGTAACCTTGGGTTCTCGAGAACCCAAGGTTACAAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198646.1-1943s1c1
Sequence:CCGGCGTTTGATGAAATACTGGCAACTCGAGTTGCCAGTATTTCATCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198646.1-272s1c1
Sequence:CCGGGCTCAGTTTGAAATTCAGTATCTCGAGATACTGAATTTCAAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198646.1-938s1c1
Sequence:CCGGGCACTCACTTTGTAAGTAGTACTCGAGTACTACTTACAAAGTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198646.1-323s1c1
Sequence:CCGGGAGTTGTTTCTTGAGATACTTCTCGAGAAGTATCTCAAGAAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198646.1-152s1c1
Sequence:CCGGGCAATTACTGACCGTGTGAGACTCGAGTCTCACACGGTCAGTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198646.1-53s1c1
Sequence:CCGGCCTTTAGTGCATGACTTGATTCTCGAGAATCAAGTCATGCACTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198646
ERMARD MISSION shRNA Lentiviral Transduction Particles
ER membrane-associated RNA degradation
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198646.1-307s1c1
Sequence:CCGGGTGGACAACTTATCCAGAGTTCTCGAGAACTCTGGATAAGTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198646.1-171s1c1
Sequence:CCGGGATATGAAGAATTAGGGCGAACTCGAGTTCGCCCTAATTCTTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198646.1-67s1c1
Sequence:CCGGCTTGATTTGTAACCTTGGGTTCTCGAGAACCCAAGGTTACAAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198646.1-1943s1c1
Sequence:CCGGCGTTTGATGAAATACTGGCAACTCGAGTTGCCAGTATTTCATCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198646.1-272s1c1
Sequence:CCGGGCTCAGTTTGAAATTCAGTATCTCGAGATACTGAATTTCAAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198646.1-938s1c1
Sequence:CCGGGCACTCACTTTGTAAGTAGTACTCGAGTACTACTTACAAAGTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198646.1-323s1c1
Sequence:CCGGGAGTTGTTTCTTGAGATACTTCTCGAGAAGTATCTCAAGAAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198646.1-152s1c1
Sequence:CCGGGCAATTACTGACCGTGTGAGACTCGAGTCTCACACGGTCAGTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198646.1-53s1c1
Sequence:CCGGCCTTTAGTGCATGACTTGATTCTCGAGAATCAAGTCATGCACTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks