EMAIL THIS PAGE TO A FRIEND

ERMN

ermin, ERM-like protein

244 Gene Product Result for
Synonyms: JN KIAA1189 ermin
UniProtKB ID: Q8TAM6, B4DKA6, Q9ULN1
Gene ID:
Mouse(77767) ermin, ERM-like protein
Rat(295619) ermin, ERM-like protein
chicken(771826) ermin, ERM-like protein
cow(617274) ermin, ERM-like protein
domestic cat(101095358) ermin, ERM-like protein
dog(607626) ermin, ERM-like protein
sheep(101113731) ermin, ERM-like protein
naked mole-rat(101714209) ermin, ERM-like protein
domestic guinea pig(100724982) ermin, ERM-like protein
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029972 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029972 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029972 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020711 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054541 MISSION® esiRNA esiRNA human ERMN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009959 Rosetta Predictions human pricing
NM_020711 Rosetta Predictions human pricing
NM_001008311 Rosetta Predictions rat pricing
NM_029972 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227299 predicted 1025
2 SASI_Hs01_00227300 predicted 1210
3 SASI_Hs01_00227301 predicted 1105
4 SASI_Hs01_00227303 predicted 1291
5 SASI_Hs01_00227304 predicted 468
6 SASI_Hs01_00227305 predicted 485
7 SASI_Hs01_00227306 predicted 439
8 SASI_Hs01_00227307 predicted 1369
9 SASI_Hs02_00305751 predicted 1020
10 SASI_Hs02_00305752 predicted 1280
11 SASI_Hs01_00227302 predicted 1064
12 SASI_Hs01_00227308 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035345 predicted 1091
2 SASI_Hs01_00035346 predicted 1282
3 SASI_Hs01_00035347 predicted 1179
4 SASI_Hs01_00035349 predicted 1362
5 SASI_Hs01_00035350 predicted 538
6 SASI_Hs01_00035351 predicted 553
7 SASI_Hs01_00035352 predicted 508
8 SASI_Hs01_00035353 predicted 1442
9 SASI_Hs02_00353723 predicted 1091
10 SASI_Hs02_00353724 predicted 1350
11 SASI_Hs01_00035348 predicted 1138
12 SASI_Hs01_00035354 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047523 predicted 914
2 SASI_Rn01_00047524 predicted 882
3 SASI_Rn01_00047525 predicted 635
4 SASI_Rn01_00047526 predicted 749
5 SASI_Rn01_00047527 predicted 1041
6 SASI_Rn02_00199039 predicted 324
7 SASI_Rn01_00047528 predicted 491
8 SASI_Rn01_00047529 predicted 973
9 SASI_Rn01_00047531 predicted 372
10 SASI_Rn01_00047532 predicted 952
11 SASI_Rn01_00047530 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148390 predicted 764
2 SASI_Mm01_00148394 predicted 863
3 SASI_Mm01_00148391 predicted 836
4 SASI_Mm01_00148392 predicted 791
5 SASI_Mm01_00148393 predicted 921
6 SASI_Mm01_00148396 predicted 511
7 SASI_Mm01_00148397 predicted 309
8 SASI_Mm01_00148398 predicted 619
9 SASI_Mm01_00148399 predicted 610
10 SASI_Mm02_00336295 predicted 160
11 SASI_Mm01_00148395 predicted 894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029972
ERMN MISSION shRNA Bacterial Glycerol Stock
ermin, ERM-like protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029972.3-102s21c1
Sequence:CCGGCCAACAGCCTAGCAGTCAAACCTCGAGGTTTGACTGCTAGGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029972.3-1135s21c1
Sequence:CCGGAGCCAAGCCTGGTAGGATTTGCTCGAGCAAATCCTACCAGGCTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029972.3-864s21c1
Sequence:CCGGGTCAATGATGCACTTATAAACCTCGAGGTTTATAAGTGCATCATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029972.2-2201s1c1
Sequence:CCGGCCCGCTTAGATGATTGCTTATCTCGAGATAAGCAATCATCTAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029972.2-284s1c1
Sequence:CCGGCCAGAAGAGAACCTCTTCGTTCTCGAGAACGAAGAGGTTCTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029972.2-780s1c1
Sequence:CCGGCCAGGAATTCTTATTCCAGATCTCGAGATCTGGAATAAGAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029972.2-471s1c1
Sequence:CCGGCGAGTACAACTGAAATCGAATCTCGAGATTCGATTTCAGTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029972.2-513s1c1
Sequence:CCGGGTCCAGTTGACATCTTGCATTCTCGAGAATGCAAGATGTCAACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029972
ERMN MISSION shRNA shRNA Plasmid DNA
ermin, ERM-like protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029972.3-102s21c1
Sequence:CCGGCCAACAGCCTAGCAGTCAAACCTCGAGGTTTGACTGCTAGGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029972.3-1135s21c1
Sequence:CCGGAGCCAAGCCTGGTAGGATTTGCTCGAGCAAATCCTACCAGGCTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029972.3-864s21c1
Sequence:CCGGGTCAATGATGCACTTATAAACCTCGAGGTTTATAAGTGCATCATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029972.2-2201s1c1
Sequence:CCGGCCCGCTTAGATGATTGCTTATCTCGAGATAAGCAATCATCTAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029972.2-284s1c1
Sequence:CCGGCCAGAAGAGAACCTCTTCGTTCTCGAGAACGAAGAGGTTCTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029972.2-780s1c1
Sequence:CCGGCCAGGAATTCTTATTCCAGATCTCGAGATCTGGAATAAGAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029972.2-471s1c1
Sequence:CCGGCGAGTACAACTGAAATCGAATCTCGAGATTCGATTTCAGTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029972.2-513s1c1
Sequence:CCGGGTCCAGTTGACATCTTGCATTCTCGAGAATGCAAGATGTCAACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029972
ERMN MISSION shRNA Lentiviral Transduction Particles
ermin, ERM-like protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029972.3-102s21c1
Sequence:CCGGCCAACAGCCTAGCAGTCAAACCTCGAGGTTTGACTGCTAGGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029972.3-1135s21c1
Sequence:CCGGAGCCAAGCCTGGTAGGATTTGCTCGAGCAAATCCTACCAGGCTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029972.3-864s21c1
Sequence:CCGGGTCAATGATGCACTTATAAACCTCGAGGTTTATAAGTGCATCATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029972.2-2201s1c1
Sequence:CCGGCCCGCTTAGATGATTGCTTATCTCGAGATAAGCAATCATCTAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029972.2-284s1c1
Sequence:CCGGCCAGAAGAGAACCTCTTCGTTCTCGAGAACGAAGAGGTTCTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029972.2-780s1c1
Sequence:CCGGCCAGGAATTCTTATTCCAGATCTCGAGATCTGGAATAAGAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029972.2-471s1c1
Sequence:CCGGCGAGTACAACTGAAATCGAATCTCGAGATTCGATTTCAGTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029972.2-513s1c1
Sequence:CCGGGTCCAGTTGACATCTTGCATTCTCGAGAATGCAAGATGTCAACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020711
ERMN MISSION shRNA Bacterial Glycerol Stock
ermin, ERM-like protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020711.1-2172s1c1
Sequence:CCGGGCCCAAATCAAGATGCTTAAACTCGAGTTTAAGCATCTTGATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020711.1-325s1c1
Sequence:CCGGCGGTCAACAAACAATCACTAACTCGAGTTAGTGATTGTTTGTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020711.1-634s1c1
Sequence:CCGGCCAGGAAATAAGAAGACAGAACTCGAGTTCTGTCTTCTTATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020711.1-974s1c1
Sequence:CCGGCCTGATGAGCAGCCAACCTTACTCGAGTAAGGTTGGCTGCTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020711.1-509s1c1
Sequence:CCGGCCAGAAGAGAAACTCTTTATTCTCGAGAATAAAGAGTTTCTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020711
ERMN MISSION shRNA shRNA Plasmid DNA
ermin, ERM-like protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020711.1-2172s1c1
Sequence:CCGGGCCCAAATCAAGATGCTTAAACTCGAGTTTAAGCATCTTGATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020711.1-325s1c1
Sequence:CCGGCGGTCAACAAACAATCACTAACTCGAGTTAGTGATTGTTTGTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020711.1-634s1c1
Sequence:CCGGCCAGGAAATAAGAAGACAGAACTCGAGTTCTGTCTTCTTATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020711.1-974s1c1
Sequence:CCGGCCTGATGAGCAGCCAACCTTACTCGAGTAAGGTTGGCTGCTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020711.1-509s1c1
Sequence:CCGGCCAGAAGAGAAACTCTTTATTCTCGAGAATAAAGAGTTTCTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020711
ERMN MISSION shRNA Lentiviral Transduction Particles
ermin, ERM-like protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020711.1-2172s1c1
Sequence:CCGGGCCCAAATCAAGATGCTTAAACTCGAGTTTAAGCATCTTGATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020711.1-325s1c1
Sequence:CCGGCGGTCAACAAACAATCACTAACTCGAGTTAGTGATTGTTTGTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020711.1-634s1c1
Sequence:CCGGCCAGGAAATAAGAAGACAGAACTCGAGTTCTGTCTTCTTATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020711.1-974s1c1
Sequence:CCGGCCTGATGAGCAGCCAACCTTACTCGAGTAAGGTTGGCTGCTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020711.1-509s1c1
Sequence:CCGGCCAGAAGAGAAACTCTTTATTCTCGAGAATAAAGAGTTTCTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks