EMAIL THIS PAGE TO A FRIEND

ERMP1

endoplasmic reticulum metallopeptidase 1

93 Gene Product Result for
Synonyms: FXNA KIAA1815 bA207C16.3
UniProtKB ID: Q7Z2K6, B2RNA4, Q8N5T5, Q9H5M1
Gene ID:
Mouse(226090) endoplasmic reticulum metallopeptidase 1
Rat(373544) endoplasmic reticulum metallopeptidase 1
chicken(426644) endoplasmic reticulum metallopeptidase 1
dog(484188) endoplasmic reticulum metallopeptidase 1
domestic cat(101097600) endoplasmic reticulum metallopeptidase 1
Horse(100051763) endoplasmic reticulum metallopeptidase 1
cow(541094) endoplasmic reticulum metallopeptidase 1
domestic guinea pig(100717380) endoplasmic reticulum metallopeptidase 1
naked mole-rat(101720012) endoplasmic reticulum metallopeptidase 1
sheep(101115940) endoplasmic reticulum metallopeptidase 1
Domestic Rabbit(100345471) endoplasmic reticulum metallopeptidase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024896 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_358328 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358328 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358328 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024896 Rosetta Predictions human pricing
NM_184050 Rosetta Predictions rat pricing
NM_001081213 Rosetta Predictions mouse pricing
XM_358328 Rosetta Predictions mouse pricing
XM_900487 Rosetta Predictions mouse pricing
XM_900496 Rosetta Predictions mouse pricing
XM_900498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229236 predicted 2262
2 SASI_Hs02_00357492 predicted 2219
3 SASI_Hs01_00229237 predicted 1190
4 SASI_Hs01_00229238 predicted 937
5 SASI_Hs01_00229239 predicted 1714
6 SASI_Hs01_00229240 predicted 1121
7 SASI_Hs01_00229241 predicted 2438
8 SASI_Hs01_00229242 predicted 1370
9 SASI_Hs01_00229243 predicted 1497
10 SASI_Hs01_00229244 predicted 1689
11 SASI_Hs01_00229235 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030121 predicted 795
2 SASI_Rn01_00030122 predicted 1383
3 SASI_Rn02_00269905 predicted 1322
4 SASI_Rn01_00030123 predicted 2643
5 SASI_Rn01_00030124 predicted 513
6 SASI_Rn01_00030125 predicted 2046
7 SASI_Rn01_00030126 predicted 456
8 SASI_Rn01_00030127 predicted 2772
9 SASI_Rn01_00030128 predicted 2020
10 SASI_Rn02_00269906 predicted 331
11 SASI_Rn01_00030129 predicted 2584
12 SASI_Rn01_00030130 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081213 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296291 predicted 845
2 SASI_Mm02_00296292 predicted 2161
3 SASI_Mm02_00296293 predicted 2098
4 SASI_Mm02_00296294 predicted 2203
5 SASI_Mm02_00296295 predicted 2629
6 SASI_Mm02_00296296 predicted 1798
7 SASI_Mm02_00296297 predicted 1600
8 SASI_Mm02_00296298 predicted 1995
9 SASI_Mm02_00296299 predicted 654
10 SASI_Mm02_00296300 predicted 2582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236403 predicted 2166
2 SASI_Mm01_00236404 predicted 2103
3 SASI_Mm01_00236405 predicted 2355
4 SASI_Mm01_00236406 predicted 1982
5 SASI_Mm01_00236407 predicted 2214
6 SASI_Mm01_00236408 predicted 2282
7 SASI_Mm01_00236409 predicted 2212
8 SASI_Mm01_00236410 predicted 2179
9 SASI_Mm01_00236411 predicted 2179
10 SASI_Mm01_00236412 predicted 2004
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281230 predicted 383
2 SASI_Mm01_00281231 predicted 732
3 SASI_Mm01_00281232 predicted 798
4 SASI_Mm01_00281233 predicted 690
5 SASI_Mm01_00281234 predicted 829
6 SASI_Mm01_00281235 predicted 796
7 SASI_Mm01_00281236 predicted 720
8 SASI_Mm01_00281237 predicted 911
9 SASI_Mm01_00281238 predicted 786
10 SASI_Mm01_00281239 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211085 predicted 853
2 SASI_Mm01_00211086 predicted 2167
3 SASI_Mm01_00211087 predicted 2106
4 SASI_Mm01_00211088 predicted 2212
5 SASI_Mm01_00211089 predicted 2176
6 SASI_Mm01_00211090 predicted 944
7 SASI_Mm01_00211091 predicted 1807
8 SASI_Mm01_00211092 predicted 1605
9 SASI_Mm01_00211093 predicted 2001
10 SASI_Mm01_00211094 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241667 predicted 855
2 SASI_Mm01_00241668 predicted 1064
3 SASI_Mm01_00241669 predicted 1427
4 SASI_Mm01_00241670 predicted 1138
5 SASI_Mm01_00241671 predicted 951
6 SASI_Mm01_00241672 predicted 1504
7 SASI_Mm01_00241673 predicted 664
8 SASI_Mm01_00241674 predicted 855
9 SASI_Mm01_00241675 predicted 1113
10 SASI_Mm01_00241676 predicted 1130
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024896
VALIDATED
ERMP1 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum metallopeptidase 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024896.2-2578s1c1
Sequence:CCGGGCATGGCAGTTCTGGATAGAACTCGAGTTCTATCCAGAACTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024896.2-4606s1c1
Sequence:CCGGCCGTGGTTCATCTGATATAATCTCGAGATTATATCAGATGAACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024896.2-561s1c1
Sequence:CCGGCATTGATTTCTTGGGAGGTTTCTCGAGAAACCTCCCAAGAAATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024896.2-1028s1c1
Sequence:CCGGCTTCAGATACTGACTTTCGTACTCGAGTACGAAAGTCAGTATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024896.2-4726s1c1
Sequence:CCGGCCTGTGTAAACCATTGTCTTTCTCGAGAAAGACAATGGTTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024896.2-600s1c1
Sequence:CCGGCATCACCAATGTTGTGGTAAACTCGAGTTTACCACAACATTGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024896.2-2744s1c1
Sequence:CCGGGCACCTACGATCTCTTTGTATCTCGAGATACAAAGAGATCGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024896.2-1368s1c1
Sequence:CCGGGCCCAAACATAAGACTGGTAACTCGAGTTACCAGTCTTATGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024896.2-4606s21c1
Sequence:CCGGCCGTGGTTCATCTGATATAATCTCGAGATTATATCAGATGAACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_024896.2-1690s21c1
Sequence:CCGGGGACTTTGCTCGGCGTTTATTCTCGAGAATAAACGCCGAGCAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024896.2-1843s21c1
Sequence:CCGGTACCTCATCTGGGCAGTATTTCTCGAGAAATACTGCCCAGATGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024896.2-1295s21c1
Sequence:CCGGCTCGTATTGGCTCAATCATAACTCGAGTTATGATTGAGCCAATACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024896.2-2744s21c1
Sequence:CCGGGCACCTACGATCTCTTTGTATCTCGAGATACAAAGAGATCGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024896
VALIDATED
ERMP1 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum metallopeptidase 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024896.2-2578s1c1
Sequence:CCGGGCATGGCAGTTCTGGATAGAACTCGAGTTCTATCCAGAACTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024896.2-4606s1c1
Sequence:CCGGCCGTGGTTCATCTGATATAATCTCGAGATTATATCAGATGAACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024896.2-561s1c1
Sequence:CCGGCATTGATTTCTTGGGAGGTTTCTCGAGAAACCTCCCAAGAAATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024896.2-1028s1c1
Sequence:CCGGCTTCAGATACTGACTTTCGTACTCGAGTACGAAAGTCAGTATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024896.2-4726s1c1
Sequence:CCGGCCTGTGTAAACCATTGTCTTTCTCGAGAAAGACAATGGTTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024896.2-600s1c1
Sequence:CCGGCATCACCAATGTTGTGGTAAACTCGAGTTTACCACAACATTGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024896.2-2744s1c1
Sequence:CCGGGCACCTACGATCTCTTTGTATCTCGAGATACAAAGAGATCGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024896.2-1368s1c1
Sequence:CCGGGCCCAAACATAAGACTGGTAACTCGAGTTACCAGTCTTATGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024896.2-4606s21c1
Sequence:CCGGCCGTGGTTCATCTGATATAATCTCGAGATTATATCAGATGAACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_024896.2-1690s21c1
Sequence:CCGGGGACTTTGCTCGGCGTTTATTCTCGAGAATAAACGCCGAGCAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024896.2-1843s21c1
Sequence:CCGGTACCTCATCTGGGCAGTATTTCTCGAGAAATACTGCCCAGATGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024896.2-1295s21c1
Sequence:CCGGCTCGTATTGGCTCAATCATAACTCGAGTTATGATTGAGCCAATACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024896.2-2744s21c1
Sequence:CCGGGCACCTACGATCTCTTTGTATCTCGAGATACAAAGAGATCGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024896
VALIDATED
ERMP1 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum metallopeptidase 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024896.2-2578s1c1
Sequence:CCGGGCATGGCAGTTCTGGATAGAACTCGAGTTCTATCCAGAACTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024896.2-4606s1c1
Sequence:CCGGCCGTGGTTCATCTGATATAATCTCGAGATTATATCAGATGAACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024896.2-561s1c1
Sequence:CCGGCATTGATTTCTTGGGAGGTTTCTCGAGAAACCTCCCAAGAAATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024896.2-1028s1c1
Sequence:CCGGCTTCAGATACTGACTTTCGTACTCGAGTACGAAAGTCAGTATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024896.2-4726s1c1
Sequence:CCGGCCTGTGTAAACCATTGTCTTTCTCGAGAAAGACAATGGTTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024896.2-600s1c1
Sequence:CCGGCATCACCAATGTTGTGGTAAACTCGAGTTTACCACAACATTGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024896.2-2744s1c1
Sequence:CCGGGCACCTACGATCTCTTTGTATCTCGAGATACAAAGAGATCGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024896.2-1368s1c1
Sequence:CCGGGCCCAAACATAAGACTGGTAACTCGAGTTACCAGTCTTATGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024896.2-4606s21c1
Sequence:CCGGCCGTGGTTCATCTGATATAATCTCGAGATTATATCAGATGAACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_024896.2-1690s21c1
Sequence:CCGGGGACTTTGCTCGGCGTTTATTCTCGAGAATAAACGCCGAGCAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024896.2-1843s21c1
Sequence:CCGGTACCTCATCTGGGCAGTATTTCTCGAGAAATACTGCCCAGATGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024896.2-1295s21c1
Sequence:CCGGCTCGTATTGGCTCAATCATAACTCGAGTTATGATTGAGCCAATACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024896.2-2744s21c1
Sequence:CCGGGCACCTACGATCTCTTTGTATCTCGAGATACAAAGAGATCGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358328
VALIDATED
ERMP1 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum metallopeptidase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358328.1-712s1c1
Sequence:CCGGCCCACAAAGGATCAACACTTTCTCGAGAAAGTGTTGATCCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358328.1-651s1c1
Sequence:CCGGGATTCGATAAAGTTGACCTTTCTCGAGAAAGGTCAACTTTATCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358328.1-101s1c1
Sequence:CCGGGTTTGAGATGTTCACTCCTATCTCGAGATAGGAGTGAACATCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358328.1-224s1c1
Sequence:CCGGCCTTGTGAACAGCACAAAGAACTCGAGTTCTTTGTGCTGTTCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358328.1-336s1c1
Sequence:CCGGCCAAAGCCAAAGAGAGTGTTTCTCGAGAAACACTCTCTTTGGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358328
VALIDATED
ERMP1 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum metallopeptidase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358328.1-712s1c1
Sequence:CCGGCCCACAAAGGATCAACACTTTCTCGAGAAAGTGTTGATCCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358328.1-651s1c1
Sequence:CCGGGATTCGATAAAGTTGACCTTTCTCGAGAAAGGTCAACTTTATCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358328.1-101s1c1
Sequence:CCGGGTTTGAGATGTTCACTCCTATCTCGAGATAGGAGTGAACATCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358328.1-224s1c1
Sequence:CCGGCCTTGTGAACAGCACAAAGAACTCGAGTTCTTTGTGCTGTTCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358328.1-336s1c1
Sequence:CCGGCCAAAGCCAAAGAGAGTGTTTCTCGAGAAACACTCTCTTTGGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358328
VALIDATED
ERMP1 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum metallopeptidase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358328.1-712s1c1
Sequence:CCGGCCCACAAAGGATCAACACTTTCTCGAGAAAGTGTTGATCCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358328.1-651s1c1
Sequence:CCGGGATTCGATAAAGTTGACCTTTCTCGAGAAAGGTCAACTTTATCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358328.1-101s1c1
Sequence:CCGGGTTTGAGATGTTCACTCCTATCTCGAGATAGGAGTGAACATCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358328.1-224s1c1
Sequence:CCGGCCTTGTGAACAGCACAAAGAACTCGAGTTCTTTGTGCTGTTCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358328.1-336s1c1
Sequence:CCGGCCAAAGCCAAAGAGAGTGTTTCTCGAGAAACACTCTCTTTGGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks