EMAIL THIS PAGE TO A FRIEND

ERN1

endoplasmic reticulum to nucleus signaling 1

Synonyms: IRE1 IRE1P IRE1a hIRE1p
UniProtKB ID: O75460, A1L457, A8K8N8, A8MXS7, Q59EE2
Gene ID:
Human(2081) Summary: The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals. [provided by RefSeq, Jul 2008]
Mouse(78943) endoplasmic reticulum (ER) to nucleus signalling 1
Rat(498013) endoplasmic reticulum to nucleus signaling 1
sheep(101102746) endoplasmic reticulum to nucleus signaling 1
naked mole-rat(101714734) endoplasmic reticulum to nucleus signaling 1
domestic guinea pig(100733391) endoplasmic reticulum to nucleus signaling 1
Zebrafish(553551) endoplasmic reticulum to nucleus signaling 1
chicken(771230) endoplasmic reticulum to nucleus signaling 1
cow(524719) endoplasmic reticulum to nucleus signaling 1
Horse(100064339) endoplasmic reticulum to nucleus signaling 1
domestic cat(101084148) endoplasmic reticulum to nucleus signaling 1
dog(610766) endoplasmic reticulum to nucleus signaling 1
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412027 ANTI-ERN1 antibody produced in mouse clone 1F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412028 ANTI-ERN1 antibody produced in mouse clone 5F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412029 ANTI-ERN1 antibody produced in mouse clone 6G11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412341 ANTI-ERN1 antibody produced in mouse clone 4E1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412645 ANTI-ERN1 antibody produced in mouse clone 4D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA027730 Anti-ERN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2500366 Anti-ERN1/IRE1A antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, canine, rat
ELISA, western blot pricing
I6785 Anti-IRE1α antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation, western blot pricing
PRS3655 Anti-IRE1P (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
PRS3657 Anti-IRE1P (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
PRS3659 Anti-IRE1P (ab3) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1302332 ANTI-MOUSE ERN1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
WH0002081M2 Monoclonal Anti-ERN1 antibody produced in mouse clone 8D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403792 Monoclonal Anti-ERN1 antibody produced in mouse clone 3D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB5300474 Monoclonal Anti-ERN1 antibody produced in mouse clone 9F2, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001433 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002721 MISSION® esiRNA esiRNA targeting human ERN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001433 Rosetta Predictions human pricing
NM_152461 Rosetta Predictions human pricing
XM_001081576 Rosetta Predictions rat pricing
XM_573211 Rosetta Predictions rat pricing
NM_023913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194923 predicted 2768
2 SASI_Hs01_00194924 predicted 539
3 SASI_Hs02_00331841 predicted 2512
4 SASI_Hs01_00194927 predicted 1222
5 SASI_Hs01_00194928 predicted 2782
6 SASI_Hs02_00331842 predicted 1126
7 SASI_Hs01_00194929 predicted 516
8 SASI_Hs01_00194930 predicted 2325
9 SASI_Hs02_00331843 predicted 641
10 SASI_Hs01_00194932 predicted 453
11 SASI_Hs01_00194925 predicted 941
12 SASI_Hs01_00194926 predicted 2479
13 SASI_Hs01_00194931 predicted 2147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026921 predicted 780
2 SASI_Hs01_00026922 predicted 781
3 SASI_Hs01_00026923 predicted 780
4 SASI_Hs01_00026924 predicted 777
5 SASI_Hs01_00026925 predicted 784
6 SASI_Hs01_00026926 predicted 592
7 SASI_Hs01_00026927 predicted 602
8 SASI_Hs01_00026928 predicted 1080
9 SASI_Hs01_00026929 predicted 1246
10 SASI_Hs01_00026930 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372535 predicted 1677
2 SASI_Rn02_00372536 predicted 1692
3 SASI_Rn02_00372537 predicted 631
4 SASI_Rn02_00372538 predicted 838
5 SASI_Rn02_00372539 predicted 811
6 SASI_Rn02_00372540 predicted 1542
7 SASI_Rn02_00372541 predicted 2341
8 SASI_Rn02_00372542 predicted 816
9 SASI_Rn02_00372543 predicted 3500
10 SASI_Rn02_00372544 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400004 predicted 1158
2 SASI_Rn02_00400005 predicted 1180
3 SASI_Rn02_00400006 predicted 327
4 SASI_Rn02_00400007 predicted 293
5 SASI_Rn02_00400008 predicted 983
6 SASI_Rn02_00400009 predicted 1036
7 SASI_Rn02_00400010 predicted 1099
8 SASI_Rn02_00400011 predicted 297
9 SASI_Rn02_00400012 predicted 302
10 SASI_Rn02_00400013 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042550 predicted 567
2 SASI_Mm01_00042551 predicted 350
3 SASI_Mm01_00042552 predicted 483
4 SASI_Mm01_00042553 predicted 464
5 SASI_Mm01_00042554 predicted 970
6 SASI_Mm01_00042555 predicted 3139
7 SASI_Mm01_00042556 predicted 1185
8 SASI_Mm01_00042557 predicted 1139
9 SASI_Mm01_00042558 predicted 1984
10 SASI_Mm01_00042559 predicted 1259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001433
VALIDATED
ERN1 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum to nucleus signaling 1
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-2014s21c1
Sequence:CCGGACCGGCAATTCCAGTACATTGCTCGAGCAATGTACTGGAATTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-219s21c1
Sequence:CCGGTCAACGCTGGATGGAAGTTTGCTCGAGCAAACTTCCATCCAGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-2230s21c1
Sequence:CCGGAGGCCATGATCTCCGACTTTGCTCGAGCAAAGTCGGAGATCATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-2506s21c1
Sequence:CCGGAGAAGCACGAAGACGTCATTGCTCGAGCAATGACGTCTTCGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001433.3-3473s21c1
Sequence:CCGGCTTCACTGGAGACCGGAATTGCTCGAGCAATTCCGGTCTCCAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-453s21c1
Sequence:CCGGGGAATCCTCTACATGGGTAAACTCGAGTTTACCCATGTAGAGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-263s21c1
Sequence:CCGGCTCAATCAAATGGACTTTAAACTCGAGTTTAAAGTCCATTTGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-1849s21c1
Sequence:CCGGATGGAGCTGAGGGCACAATTGCTCGAGCAATTGTGCCCTCAGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001433.3-3407s21c1
Sequence:CCGGAGAGGAGGGAATCGTACATTTCTCGAGAAATGTACGATTCCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-363s21c1
Sequence:CCGGACGCTTGGAAGCAAGAATAATCTCGAGATTATTCTTGCTTCCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-2771s21c1
Sequence:CCGGGCGTAAATTCAGGACCTATAACTCGAGTTATAGGTCCTGAATTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-476s21c1
Sequence:CCGGGCAGGACATCTGGTATGTTATCTCGAGATAACATACCAGATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001433.3-3090s21c1
Sequence:CCGGAGGGCCTGGTCACCACAATTACTCGAGTAATTGTGGTGACCAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001433.x-540s1c1
Sequence:CCGGCCCATCAACCTCTCTTCTGTACTCGAGTACAGAAGAGAGGTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001433.x-957s1c1
Sequence:CCGGGAAATACTCTACCAGCCTCTACTCGAGTAGAGGCTGGTAGAGTATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001433.x-2524s1c1
Sequence:CCGGGAGAAGATGATTGCGATGGATCTCGAGATCCATCGCAATCATCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001433.x-3319s1c1
Sequence:CCGGCTACTGGATAAACTTGCTTCACTCGAGTGAAGCAAGTTTATCCAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199739    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001433.2-3063s1c1
Sequence:CCGGGAGGGCCTGGTCACCACAATTCTCGAGAATTGTGGTGACCAGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001433.2-1140s1c1
Sequence:CCGGGCTCAACTACTTGAGGAATTACTCGAGTAATTCCTCAAGTAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001433.2-3344s1c1
Sequence:CCGGCCTGCTTAATGTCAGTCTACACTCGAGTGTAGACTGACATTAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001433
VALIDATED
ERN1 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum to nucleus signaling 1
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-2014s21c1
Sequence:CCGGACCGGCAATTCCAGTACATTGCTCGAGCAATGTACTGGAATTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-219s21c1
Sequence:CCGGTCAACGCTGGATGGAAGTTTGCTCGAGCAAACTTCCATCCAGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-2230s21c1
Sequence:CCGGAGGCCATGATCTCCGACTTTGCTCGAGCAAAGTCGGAGATCATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-2506s21c1
Sequence:CCGGAGAAGCACGAAGACGTCATTGCTCGAGCAATGACGTCTTCGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001433.3-3473s21c1
Sequence:CCGGCTTCACTGGAGACCGGAATTGCTCGAGCAATTCCGGTCTCCAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-453s21c1
Sequence:CCGGGGAATCCTCTACATGGGTAAACTCGAGTTTACCCATGTAGAGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-263s21c1
Sequence:CCGGCTCAATCAAATGGACTTTAAACTCGAGTTTAAAGTCCATTTGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-1849s21c1
Sequence:CCGGATGGAGCTGAGGGCACAATTGCTCGAGCAATTGTGCCCTCAGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001433.3-3407s21c1
Sequence:CCGGAGAGGAGGGAATCGTACATTTCTCGAGAAATGTACGATTCCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-363s21c1
Sequence:CCGGACGCTTGGAAGCAAGAATAATCTCGAGATTATTCTTGCTTCCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-2771s21c1
Sequence:CCGGGCGTAAATTCAGGACCTATAACTCGAGTTATAGGTCCTGAATTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-476s21c1
Sequence:CCGGGCAGGACATCTGGTATGTTATCTCGAGATAACATACCAGATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001433.3-3090s21c1
Sequence:CCGGAGGGCCTGGTCACCACAATTACTCGAGTAATTGTGGTGACCAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001433.x-540s1c1
Sequence:CCGGCCCATCAACCTCTCTTCTGTACTCGAGTACAGAAGAGAGGTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001433.x-957s1c1
Sequence:CCGGGAAATACTCTACCAGCCTCTACTCGAGTAGAGGCTGGTAGAGTATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001433.x-2524s1c1
Sequence:CCGGGAGAAGATGATTGCGATGGATCTCGAGATCCATCGCAATCATCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001433.x-3319s1c1
Sequence:CCGGCTACTGGATAAACTTGCTTCACTCGAGTGAAGCAAGTTTATCCAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199739    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001433.2-3063s1c1
Sequence:CCGGGAGGGCCTGGTCACCACAATTCTCGAGAATTGTGGTGACCAGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001433.2-1140s1c1
Sequence:CCGGGCTCAACTACTTGAGGAATTACTCGAGTAATTCCTCAAGTAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001433.2-3344s1c1
Sequence:CCGGCCTGCTTAATGTCAGTCTACACTCGAGTGTAGACTGACATTAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001433
VALIDATED
ERN1 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum to nucleus signaling 1
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-2014s21c1
Sequence:CCGGACCGGCAATTCCAGTACATTGCTCGAGCAATGTACTGGAATTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-219s21c1
Sequence:CCGGTCAACGCTGGATGGAAGTTTGCTCGAGCAAACTTCCATCCAGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-2230s21c1
Sequence:CCGGAGGCCATGATCTCCGACTTTGCTCGAGCAAAGTCGGAGATCATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-2506s21c1
Sequence:CCGGAGAAGCACGAAGACGTCATTGCTCGAGCAATGACGTCTTCGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001433.3-3473s21c1
Sequence:CCGGCTTCACTGGAGACCGGAATTGCTCGAGCAATTCCGGTCTCCAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-453s21c1
Sequence:CCGGGGAATCCTCTACATGGGTAAACTCGAGTTTACCCATGTAGAGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-263s21c1
Sequence:CCGGCTCAATCAAATGGACTTTAAACTCGAGTTTAAAGTCCATTTGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-1849s21c1
Sequence:CCGGATGGAGCTGAGGGCACAATTGCTCGAGCAATTGTGCCCTCAGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001433.3-3407s21c1
Sequence:CCGGAGAGGAGGGAATCGTACATTTCTCGAGAAATGTACGATTCCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-363s21c1
Sequence:CCGGACGCTTGGAAGCAAGAATAATCTCGAGATTATTCTTGCTTCCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-2771s21c1
Sequence:CCGGGCGTAAATTCAGGACCTATAACTCGAGTTATAGGTCCTGAATTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001433.3-476s21c1
Sequence:CCGGGCAGGACATCTGGTATGTTATCTCGAGATAACATACCAGATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001433.3-3090s21c1
Sequence:CCGGAGGGCCTGGTCACCACAATTACTCGAGTAATTGTGGTGACCAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001433.x-540s1c1
Sequence:CCGGCCCATCAACCTCTCTTCTGTACTCGAGTACAGAAGAGAGGTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001433.x-957s1c1
Sequence:CCGGGAAATACTCTACCAGCCTCTACTCGAGTAGAGGCTGGTAGAGTATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001433.x-2524s1c1
Sequence:CCGGGAGAAGATGATTGCGATGGATCTCGAGATCCATCGCAATCATCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001433.x-3319s1c1
Sequence:CCGGCTACTGGATAAACTTGCTTCACTCGAGTGAAGCAAGTTTATCCAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199739    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001433.2-3063s1c1
Sequence:CCGGGAGGGCCTGGTCACCACAATTCTCGAGAATTGTGGTGACCAGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001433.2-1140s1c1
Sequence:CCGGGCTCAACTACTTGAGGAATTACTCGAGTAATTCCTCAAGTAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001433.2-3344s1c1
Sequence:CCGGCCTGCTTAATGTCAGTCTACACTCGAGTGTAGACTGACATTAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023913
VALIDATED
ERN1 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum to nucleus signaling 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023913.2-3710s21c1
Sequence:CCGGCCAGCACAGTGGCCTAAATAGCTCGAGCTATTTAGGCCACTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023913.2-2767s21c1
Sequence:CCGGCAGACAGATCTGCGCAAATTCCTCGAGGAATTTGCGCAGATCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023913.2-2513s21c1
Sequence:CCGGACAAGCATGAGGACGTCATTGCTCGAGCAATGACGTCCTCATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023913.2-1856s21c1
Sequence:CCGGATGGAGCTGAGGGCACAATTGCTCGAGCAATTGTGCCCTCAGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023913.2-1448s21c1
Sequence:CCGGTCAAGGACATGGCTACCATTACTCGAGTAATGGTAGCCATGTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-3361s1c1
Sequence:CCGGCCCACTTCTCTTTCTTTCTAACTCGAGTTAGAAAGAAAGAGAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-1987s1c1
Sequence:CCGGCCAAATGTGATCCGCTACTTTCTCGAGAAAGTAGCGGATCACATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-1179s1c1
Sequence:CCGGGCTGAACTACTTGAGGAATTACTCGAGTAATTCCTCAAGTAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-2533s1c1
Sequence:CCGGGCTCGTGAATTGATAGAGAAACTCGAGTTTCTCTATCAATTCACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-401s1c1
Sequence:CCGGGCCTGACGAAACTTCCCTTTACTCGAGTAAAGGGAAGTTTCGTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023913
VALIDATED
ERN1 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum to nucleus signaling 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023913.2-3710s21c1
Sequence:CCGGCCAGCACAGTGGCCTAAATAGCTCGAGCTATTTAGGCCACTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023913.2-2767s21c1
Sequence:CCGGCAGACAGATCTGCGCAAATTCCTCGAGGAATTTGCGCAGATCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023913.2-2513s21c1
Sequence:CCGGACAAGCATGAGGACGTCATTGCTCGAGCAATGACGTCCTCATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023913.2-1856s21c1
Sequence:CCGGATGGAGCTGAGGGCACAATTGCTCGAGCAATTGTGCCCTCAGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023913.2-1448s21c1
Sequence:CCGGTCAAGGACATGGCTACCATTACTCGAGTAATGGTAGCCATGTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-3361s1c1
Sequence:CCGGCCCACTTCTCTTTCTTTCTAACTCGAGTTAGAAAGAAAGAGAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-1987s1c1
Sequence:CCGGCCAAATGTGATCCGCTACTTTCTCGAGAAAGTAGCGGATCACATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-1179s1c1
Sequence:CCGGGCTGAACTACTTGAGGAATTACTCGAGTAATTCCTCAAGTAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-2533s1c1
Sequence:CCGGGCTCGTGAATTGATAGAGAAACTCGAGTTTCTCTATCAATTCACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-401s1c1
Sequence:CCGGGCCTGACGAAACTTCCCTTTACTCGAGTAAAGGGAAGTTTCGTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023913
VALIDATED
ERN1 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum to nucleus signaling 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023913.2-3710s21c1
Sequence:CCGGCCAGCACAGTGGCCTAAATAGCTCGAGCTATTTAGGCCACTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023913.2-2767s21c1
Sequence:CCGGCAGACAGATCTGCGCAAATTCCTCGAGGAATTTGCGCAGATCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023913.2-2513s21c1
Sequence:CCGGACAAGCATGAGGACGTCATTGCTCGAGCAATGACGTCCTCATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023913.2-1856s21c1
Sequence:CCGGATGGAGCTGAGGGCACAATTGCTCGAGCAATTGTGCCCTCAGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023913.2-1448s21c1
Sequence:CCGGTCAAGGACATGGCTACCATTACTCGAGTAATGGTAGCCATGTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-3361s1c1
Sequence:CCGGCCCACTTCTCTTTCTTTCTAACTCGAGTTAGAAAGAAAGAGAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-1987s1c1
Sequence:CCGGCCAAATGTGATCCGCTACTTTCTCGAGAAAGTAGCGGATCACATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-1179s1c1
Sequence:CCGGGCTGAACTACTTGAGGAATTACTCGAGTAATTCCTCAAGTAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-2533s1c1
Sequence:CCGGGCTCGTGAATTGATAGAGAAACTCGAGTTTCTCTATCAATTCACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023913.2-401s1c1
Sequence:CCGGGCCTGACGAAACTTCCCTTTACTCGAGTAAAGGGAAGTTTCGTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks