EMAIL THIS PAGE TO A FRIEND

ERN2

endoplasmic reticulum to nucleus signaling 2

58 Gene Product Result for
Synonyms: IRE1-BETA IRE1b
UniProtKB ID: Q76MJ5, Q6ZNC0
Gene ID:
Mouse(26918) endoplasmic reticulum (ER) to nucleus signalling 2
Rat(365363) endoplasmic reticulum to nucleus signaling 2
Zebrafish(567021) endoplasmic reticulum to nucleus signaling 2
cow(508486) endoplasmic reticulum to nucleus signaling 2
domestic cat(101089482) endoplasmic reticulum to nucleus signaling 2
dog(489970) endoplasmic reticulum to nucleus signaling 2
domestic guinea pig(100717141) endoplasmic reticulum to nucleus signaling 2
naked mole-rat(101721039) endoplasmic reticulum to nucleus signaling 2
sheep(101117900) endoplasmic reticulum to nucleus signaling 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033266 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012016 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012016 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012016 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068011 MISSION® esiRNA esiRNA human ERN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033266 Rosetta Predictions human pricing
NM_001108919 Rosetta Predictions rat pricing
NM_012016 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127217 predicted 603
2 SASI_Hs01_00127218 predicted 500
3 SASI_Hs01_00127219 predicted 2808
4 SASI_Hs01_00127220 predicted 1286
5 SASI_Hs01_00127222 predicted 1181
6 SASI_Hs02_00361062 predicted 603
7 SASI_Hs02_00361063 predicted 2810
8 SASI_Hs01_00127223 predicted 2446
9 SASI_Hs02_00361064 predicted 610
10 SASI_Hs01_00127224 predicted 526
11 SASI_Hs01_00127215 predicted 1188
12 SASI_Hs01_00127216 predicted 528
13 SASI_Hs01_00127221 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243384 predicted 234
2 SASI_Rn02_00243385 predicted 316
3 SASI_Rn02_00243386 predicted 1828
4 SASI_Rn02_00243387 predicted 989
5 SASI_Rn02_00243388 predicted 2434
6 SASI_Rn02_00243389 predicted 615
7 SASI_Rn02_00243390 predicted 1875
8 SASI_Rn02_00243391 predicted 597
9 SASI_Rn02_00243392 predicted 1407
10 SASI_Rn02_00243393 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047350 predicted 1915
2 SASI_Mm01_00047352 predicted 2461
3 SASI_Mm01_00047353 predicted 506
4 SASI_Mm01_00047354 predicted 2532
5 SASI_Mm01_00047355 predicted 1194
6 SASI_Mm01_00047356 predicted 1026
7 SASI_Mm01_00047358 predicted 497
8 SASI_Mm01_00047359 predicted 1906
9 SASI_Mm02_00321960 predicted 273
10 SASI_Mm02_00321961 predicted 355
11 SASI_Mm01_00047351 predicted 1453
12 SASI_Mm01_00047357 predicted 2000
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033266
ERN2 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum to nucleus signaling 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033266.2-3127s1c1
Sequence:CCGGGCTGGCTCACTGAAGAGCTGACTCGAGTCAGCTCTTCAGTGAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-1719s1c1
Sequence:CCGGCTGCAGACTTTGCTCACATCTCTCGAGAGATGTGAGCAAAGTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-517s1c1
Sequence:CCGGCGTCATCGAAGGACCAATGTACTCGAGTACATTGGTCCTTCGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-1197s1c1
Sequence:CCGGCTGGCTTCTATGTCTCTAAAGCTCGAGCTTTAGAGACATAGAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033266.2-3228s1c1
Sequence:CCGGGATCACTTGAGCTCAGGAGTTCTCGAGAACTCCTGAGCTCAAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-1186s1c1
Sequence:CCGGGAAGGATGAAACTGGCTTCTACTCGAGTAGAAGCCAGTTTCATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-1861s1c1
Sequence:CCGGGAAGATTTCCTTCAATCCCAACTCGAGTTGGGATTGAAGGAAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033266
ERN2 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum to nucleus signaling 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033266.2-3127s1c1
Sequence:CCGGGCTGGCTCACTGAAGAGCTGACTCGAGTCAGCTCTTCAGTGAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-1719s1c1
Sequence:CCGGCTGCAGACTTTGCTCACATCTCTCGAGAGATGTGAGCAAAGTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-517s1c1
Sequence:CCGGCGTCATCGAAGGACCAATGTACTCGAGTACATTGGTCCTTCGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-1197s1c1
Sequence:CCGGCTGGCTTCTATGTCTCTAAAGCTCGAGCTTTAGAGACATAGAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033266.2-3228s1c1
Sequence:CCGGGATCACTTGAGCTCAGGAGTTCTCGAGAACTCCTGAGCTCAAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-1186s1c1
Sequence:CCGGGAAGGATGAAACTGGCTTCTACTCGAGTAGAAGCCAGTTTCATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-1861s1c1
Sequence:CCGGGAAGATTTCCTTCAATCCCAACTCGAGTTGGGATTGAAGGAAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033266
ERN2 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum to nucleus signaling 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033266.2-3127s1c1
Sequence:CCGGGCTGGCTCACTGAAGAGCTGACTCGAGTCAGCTCTTCAGTGAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-1719s1c1
Sequence:CCGGCTGCAGACTTTGCTCACATCTCTCGAGAGATGTGAGCAAAGTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-517s1c1
Sequence:CCGGCGTCATCGAAGGACCAATGTACTCGAGTACATTGGTCCTTCGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-1197s1c1
Sequence:CCGGCTGGCTTCTATGTCTCTAAAGCTCGAGCTTTAGAGACATAGAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033266.2-3228s1c1
Sequence:CCGGGATCACTTGAGCTCAGGAGTTCTCGAGAACTCCTGAGCTCAAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-1186s1c1
Sequence:CCGGGAAGGATGAAACTGGCTTCTACTCGAGTAGAAGCCAGTTTCATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033266.2-1861s1c1
Sequence:CCGGGAAGATTTCCTTCAATCCCAACTCGAGTTGGGATTGAAGGAAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012016
ERN2 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum to nucleus signaling 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-472s1c1
Sequence:CCGGGCCTCTCTACTCCTCAACTTTCTCGAGAAAGTTGAGGAGTAGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-2499s1c1
Sequence:CCGGCGCTCATACAAAGGGACATCACTCGAGTGATGTCCCTTTGTATGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-1085s1c1
Sequence:CCGGCCAGTGGCTACTCATTGGATACTCGAGTATCCAATGAGTAGCCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-903s1c1
Sequence:CCGGGCTGGGTTCTATGTCTCTAAACTCGAGTTTAGAGACATAGAACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-1865s1c1
Sequence:CCGGCCATCTACATTCCTTACACATCTCGAGATGTGTAAGGAATGTAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012016.2-631s21c1
Sequence:CCGGGAATGGCTCACCCGGGAAATACTCGAGTATTTCCCGGGTGAGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012016.2-740s21c1
Sequence:CCGGGTGCCTGTGACAGGGATTTACCTCGAGGTAAATCCCTGTCACAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012016.2-2144s21c1
Sequence:CCGGTTCTCCGCAGGCTGCGTATTTCTCGAGAAATACGCAGCCTGCGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012016
ERN2 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum to nucleus signaling 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-472s1c1
Sequence:CCGGGCCTCTCTACTCCTCAACTTTCTCGAGAAAGTTGAGGAGTAGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-2499s1c1
Sequence:CCGGCGCTCATACAAAGGGACATCACTCGAGTGATGTCCCTTTGTATGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-1085s1c1
Sequence:CCGGCCAGTGGCTACTCATTGGATACTCGAGTATCCAATGAGTAGCCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-903s1c1
Sequence:CCGGGCTGGGTTCTATGTCTCTAAACTCGAGTTTAGAGACATAGAACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-1865s1c1
Sequence:CCGGCCATCTACATTCCTTACACATCTCGAGATGTGTAAGGAATGTAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012016.2-631s21c1
Sequence:CCGGGAATGGCTCACCCGGGAAATACTCGAGTATTTCCCGGGTGAGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012016.2-740s21c1
Sequence:CCGGGTGCCTGTGACAGGGATTTACCTCGAGGTAAATCCCTGTCACAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012016.2-2144s21c1
Sequence:CCGGTTCTCCGCAGGCTGCGTATTTCTCGAGAAATACGCAGCCTGCGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012016
ERN2 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum to nucleus signaling 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-472s1c1
Sequence:CCGGGCCTCTCTACTCCTCAACTTTCTCGAGAAAGTTGAGGAGTAGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-2499s1c1
Sequence:CCGGCGCTCATACAAAGGGACATCACTCGAGTGATGTCCCTTTGTATGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-1085s1c1
Sequence:CCGGCCAGTGGCTACTCATTGGATACTCGAGTATCCAATGAGTAGCCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-903s1c1
Sequence:CCGGGCTGGGTTCTATGTCTCTAAACTCGAGTTTAGAGACATAGAACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012016.1-1865s1c1
Sequence:CCGGCCATCTACATTCCTTACACATCTCGAGATGTGTAAGGAATGTAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012016.2-631s21c1
Sequence:CCGGGAATGGCTCACCCGGGAAATACTCGAGTATTTCCCGGGTGAGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012016.2-740s21c1
Sequence:CCGGGTGCCTGTGACAGGGATTTACCTCGAGGTAAATCCCTGTCACAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012016.2-2144s21c1
Sequence:CCGGTTCTCCGCAGGCTGCGTATTTCTCGAGAAATACGCAGCCTGCGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks