EMAIL THIS PAGE TO A FRIEND

ERO1L

ERO1-like (S. cerevisiae)

140 Gene Product Result for
Synonyms: ERO1-alpha ERO1A
UniProtKB ID: Q96HE7, A8K9X4, A8MYW1, Q7LD45, Q9P1Q9, Q9UKV6
Gene ID:
Mouse(50527) ERO1-like (S. cerevisiae)
Rat(171562) ERO1-like (S. cerevisiae)
Zebrafish(393321) ERO1-like (S. cerevisiae)
fruit fly(38500) Endoplasmic reticulum oxidoreductin-1-like
chicken(423585) ERO1-like (S. cerevisiae)
dog(490691) ERO1-like (S. cerevisiae)
cow(100125317) ERO1-like (S. cerevisiae)
domestic cat(101090623) ERO1-like (S. cerevisiae)
sheep(101109883) ERO1-like (S. cerevisiae)
naked mole-rat(101716653) ERO1-like (S. cerevisiae)
domestic guinea pig(100730741) ERO1-like (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014584 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014584 Rosetta Predictions human pricing
NM_138528 Rosetta Predictions rat pricing
XM_579648 Rosetta Predictions rat pricing
NM_015774 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345858 predicted 689
2 SASI_Hs01_00147512 predicted 1272
3 SASI_Hs01_00147513 predicted 1526
4 SASI_Hs01_00147515 predicted 440
5 SASI_Hs01_00147516 predicted 816
6 SASI_Hs01_00147517 predicted 374
7 SASI_Hs01_00147518 predicted 1494
8 SASI_Hs02_00345859 predicted 1673
9 SASI_Hs01_00147519 predicted 524
10 SASI_Hs02_00345860 predicted 1248
11 SASI_Hs01_00147514 predicted 432
12 SASI_Hs01_00147520 predicted 754
13 SASI_Hs01_00147521 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082720 predicted 1049
2 SASI_Rn01_00082721 predicted 632
3 SASI_Rn01_00082722 predicted 1455
4 SASI_Rn01_00082723 predicted 735
5 SASI_Rn01_00082724 predicted 531
6 SASI_Rn01_00082725 predicted 218
7 SASI_Rn02_00268158 predicted 272
8 SASI_Rn01_00082729 predicted 1024
9 SASI_Rn02_00268159 predicted 1371
10 SASI_Rn02_00268160 predicted 597
11 SASI_Rn01_00082726 predicted 1387
12 SASI_Rn01_00082727 predicted 233
13 SASI_Rn01_00082728 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00173012 predicted 315
2 SASI_Rn01_00173013 predicted 482
3 SASI_Rn01_00173014 predicted 538
4 SASI_Rn01_00173015 predicted 536
5 SASI_Rn01_00173016 predicted 441
6 SASI_Rn01_00173017 predicted 602
7 SASI_Rn01_00173018 predicted 494
8 SASI_Rn01_00173019 predicted 343
9 SASI_Rn01_00173020 predicted 456
10 SASI_Rn01_00173021 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067746 predicted 1048
2 SASI_Mm01_00067747 predicted 492
3 SASI_Mm01_00067748 predicted 752
4 SASI_Mm01_00067749 predicted 956
5 SASI_Mm01_00067750 predicted 260
6 SASI_Mm02_00323116 predicted 1477
7 SASI_Mm01_00067752 predicted 785
8 SASI_Mm01_00067753 predicted 524
9 SASI_Mm01_00067754 predicted 1162
10 SASI_Mm01_00067755 predicted 363
11 SASI_Mm01_00067751 predicted 826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015774
ERO1L MISSION shRNA Bacterial Glycerol Stock
ERO1-like (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015774.2-528s21c1
Sequence:CCGGTCTGCGAAATTGACGATATACCTCGAGGTATATCGTCAATTTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015774.2-1049s21c1
Sequence:CCGGGCGTTACTTCTGGAGATACTTCTCGAGAAGTATCTCCAGAAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015774.2-1324s21c1
Sequence:CCGGCCAGCTAACCAGACAAGAAATCTCGAGATTTCTTGTCTGGTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015774.2-238s21c1
Sequence:CCGGGCTTCTTGAAAGTGACTACTTCTCGAGAAGTAGTCACTTTCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015774.2-1515s21c1
Sequence:CCGGGTCCTAAGCCAAACGTTTATACTCGAGTATAAACGTTTGGCTTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015774.2-1719s1c1
Sequence:CCGGGCTCTCAAACTAGAGTTGAATCTCGAGATTCAACTCTAGTTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015774.2-1324s1c1
Sequence:CCGGCCAGCTAACCAGACAAGAAATCTCGAGATTTCTTGTCTGGTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015774.2-1049s1c1
Sequence:CCGGGCGTTACTTCTGGAGATACTTCTCGAGAAGTATCTCCAGAAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015774.2-238s1c1
Sequence:CCGGGCTTCTTGAAAGTGACTACTTCTCGAGAAGTAGTCACTTTCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015774.2-1159s1c1
Sequence:CCGGCCGGCTACACTTTAGGAACATCTCGAGATGTTCCTAAAGTGTAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015774
ERO1L MISSION shRNA shRNA Plasmid DNA
ERO1-like (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015774.2-528s21c1
Sequence:CCGGTCTGCGAAATTGACGATATACCTCGAGGTATATCGTCAATTTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015774.2-1049s21c1
Sequence:CCGGGCGTTACTTCTGGAGATACTTCTCGAGAAGTATCTCCAGAAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015774.2-1324s21c1
Sequence:CCGGCCAGCTAACCAGACAAGAAATCTCGAGATTTCTTGTCTGGTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015774.2-238s21c1
Sequence:CCGGGCTTCTTGAAAGTGACTACTTCTCGAGAAGTAGTCACTTTCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015774.2-1515s21c1
Sequence:CCGGGTCCTAAGCCAAACGTTTATACTCGAGTATAAACGTTTGGCTTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015774.2-1719s1c1
Sequence:CCGGGCTCTCAAACTAGAGTTGAATCTCGAGATTCAACTCTAGTTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015774.2-1324s1c1
Sequence:CCGGCCAGCTAACCAGACAAGAAATCTCGAGATTTCTTGTCTGGTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015774.2-1049s1c1
Sequence:CCGGGCGTTACTTCTGGAGATACTTCTCGAGAAGTATCTCCAGAAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015774.2-238s1c1
Sequence:CCGGGCTTCTTGAAAGTGACTACTTCTCGAGAAGTAGTCACTTTCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015774.2-1159s1c1
Sequence:CCGGCCGGCTACACTTTAGGAACATCTCGAGATGTTCCTAAAGTGTAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015774
ERO1L MISSION shRNA Lentiviral Transduction Particles
ERO1-like (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015774.2-528s21c1
Sequence:CCGGTCTGCGAAATTGACGATATACCTCGAGGTATATCGTCAATTTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015774.2-1049s21c1
Sequence:CCGGGCGTTACTTCTGGAGATACTTCTCGAGAAGTATCTCCAGAAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015774.2-1324s21c1
Sequence:CCGGCCAGCTAACCAGACAAGAAATCTCGAGATTTCTTGTCTGGTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015774.2-238s21c1
Sequence:CCGGGCTTCTTGAAAGTGACTACTTCTCGAGAAGTAGTCACTTTCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015774.2-1515s21c1
Sequence:CCGGGTCCTAAGCCAAACGTTTATACTCGAGTATAAACGTTTGGCTTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015774.2-1719s1c1
Sequence:CCGGGCTCTCAAACTAGAGTTGAATCTCGAGATTCAACTCTAGTTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015774.2-1324s1c1
Sequence:CCGGCCAGCTAACCAGACAAGAAATCTCGAGATTTCTTGTCTGGTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015774.2-1049s1c1
Sequence:CCGGGCGTTACTTCTGGAGATACTTCTCGAGAAGTATCTCCAGAAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015774.2-238s1c1
Sequence:CCGGGCTTCTTGAAAGTGACTACTTCTCGAGAAGTAGTCACTTTCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015774.2-1159s1c1
Sequence:CCGGCCGGCTACACTTTAGGAACATCTCGAGATGTTCCTAAAGTGTAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014584
ERO1L MISSION shRNA Bacterial Glycerol Stock
ERO1-like (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014584.1-1498s21c1
Sequence:CCGGGCCAGAAAGTGGACCTAGTTACTCGAGTAACTAGGTCCACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014584.1-1340s21c1
Sequence:CCGGCACAAACTAAAGGAGGACTTTCTCGAGAAAGTCCTCCTTTAGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014584.1-752s21c1
Sequence:CCGGGCTGAATATGTAGATTTGCTTCTCGAGAAGCAAATCTACATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014584.1-1454s21c1
Sequence:CCGGACTGCTCTGAAGATCTTATTTCTCGAGAAATAAGATCTTCAGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014584.1-2020s21c1
Sequence:CCGGCCTCATAAATGACCCATAATTCTCGAGAATTATGGGTCATTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-572s1c1
Sequence:CCGGGCGAGCTACAAGTATTCTGAACTCGAGTTCAGAATACTTGTAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-1340s1c1
Sequence:CCGGCACAAACTAAAGGAGGACTTTCTCGAGAAAGTCCTCCTTTAGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-596s1c1
Sequence:CCGGGCCAATAATCTCATTGAAGAACTCGAGTTCTTCAATGAGATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-752s1c1
Sequence:CCGGGCTGAATATGTAGATTTGCTTCTCGAGAAGCAAATCTACATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-1498s1c1
Sequence:CCGGGCCAGAAAGTGGACCTAGTTACTCGAGTAACTAGGTCCACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014584
ERO1L MISSION shRNA shRNA Plasmid DNA
ERO1-like (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014584.1-1498s21c1
Sequence:CCGGGCCAGAAAGTGGACCTAGTTACTCGAGTAACTAGGTCCACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014584.1-1340s21c1
Sequence:CCGGCACAAACTAAAGGAGGACTTTCTCGAGAAAGTCCTCCTTTAGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014584.1-752s21c1
Sequence:CCGGGCTGAATATGTAGATTTGCTTCTCGAGAAGCAAATCTACATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014584.1-1454s21c1
Sequence:CCGGACTGCTCTGAAGATCTTATTTCTCGAGAAATAAGATCTTCAGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014584.1-2020s21c1
Sequence:CCGGCCTCATAAATGACCCATAATTCTCGAGAATTATGGGTCATTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-572s1c1
Sequence:CCGGGCGAGCTACAAGTATTCTGAACTCGAGTTCAGAATACTTGTAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-1340s1c1
Sequence:CCGGCACAAACTAAAGGAGGACTTTCTCGAGAAAGTCCTCCTTTAGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-596s1c1
Sequence:CCGGGCCAATAATCTCATTGAAGAACTCGAGTTCTTCAATGAGATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-752s1c1
Sequence:CCGGGCTGAATATGTAGATTTGCTTCTCGAGAAGCAAATCTACATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-1498s1c1
Sequence:CCGGGCCAGAAAGTGGACCTAGTTACTCGAGTAACTAGGTCCACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014584
ERO1L MISSION shRNA Lentiviral Transduction Particles
ERO1-like (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014584.1-1498s21c1
Sequence:CCGGGCCAGAAAGTGGACCTAGTTACTCGAGTAACTAGGTCCACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014584.1-1340s21c1
Sequence:CCGGCACAAACTAAAGGAGGACTTTCTCGAGAAAGTCCTCCTTTAGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014584.1-752s21c1
Sequence:CCGGGCTGAATATGTAGATTTGCTTCTCGAGAAGCAAATCTACATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014584.1-1454s21c1
Sequence:CCGGACTGCTCTGAAGATCTTATTTCTCGAGAAATAAGATCTTCAGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014584.1-2020s21c1
Sequence:CCGGCCTCATAAATGACCCATAATTCTCGAGAATTATGGGTCATTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-572s1c1
Sequence:CCGGGCGAGCTACAAGTATTCTGAACTCGAGTTCAGAATACTTGTAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-1340s1c1
Sequence:CCGGCACAAACTAAAGGAGGACTTTCTCGAGAAAGTCCTCCTTTAGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-596s1c1
Sequence:CCGGGCCAATAATCTCATTGAAGAACTCGAGTTCTTCAATGAGATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-752s1c1
Sequence:CCGGGCTGAATATGTAGATTTGCTTCTCGAGAAGCAAATCTACATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014584.1-1498s1c1
Sequence:CCGGGCCAGAAAGTGGACCTAGTTACTCGAGTAACTAGGTCCACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks