EMAIL THIS PAGE TO A FRIEND

ERP27

endoplasmic reticulum protein 27

112 Gene Product Result for
Synonyms: C12orf46 PDIA8
UniProtKB ID: Q96DN0
Gene ID:
Human(121506) Summary: ERP27 is a noncatalytic member of the protein disulfide isomerase (PDI; see MIM 608012) family of endoplasmic reticulum (ER) proteins (Alanen et al., 2006 [PubMed 16940051]
Mouse(69187) endoplasmic reticulum protein 27
Rat(297698) endoplasmic reticulum protein 27
sheep(101106511) endoplasmic reticulum protein 27
naked mole-rat(101702865) endoplasmic reticulum protein 27
domestic guinea pig(100734819) endoplasmic reticulum protein 27
chicken(417942) endoplasmic reticulum protein 27
cow(505855) endoplasmic reticulum protein 27
domestic cat(101096994) endoplasmic reticulum protein 27
dog(486667) endoplasmic reticulum protein 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152321 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022911 MISSION® esiRNA esiRNA human ERP27 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152321 Rosetta Predictions human pricing
NM_001106625 Rosetta Predictions rat pricing
NM_026983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365910 predicted 394
2 SASI_Hs01_00021917 predicted 669
3 SASI_Hs02_00365911 predicted 494
4 SASI_Hs02_00365912 predicted 1292
5 SASI_Hs02_00365913 predicted 331
6 SASI_Hs02_00365914 predicted 235
7 SASI_Hs02_00365915 predicted 463
8 SASI_Hs02_00365916 predicted 691
9 SASI_Hs02_00365917 predicted 213
10 SASI_Hs02_00365918 predicted 483
11 SASI_Hs01_00021914 predicted 667
12 SASI_Hs01_00021915 predicted 462
13 SASI_Hs01_00021916 predicted 1251
14 SASI_Hs01_00021918 predicted 330
15 SASI_Hs01_00021919 predicted 355
16 SASI_Hs01_00021920 predicted 400
17 SASI_Hs01_00021921 predicted 218
18 SASI_Hs01_00021922 predicted 288
19 SASI_Hs01_00021923 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220788 predicted 295
2 SASI_Rn02_00220789 predicted 751
3 SASI_Rn02_00220790 predicted 285
4 SASI_Rn02_00220791 predicted 668
5 SASI_Rn02_00220792 predicted 431
6 SASI_Rn02_00220793 predicted 371
7 SASI_Rn02_00220794 predicted 396
8 SASI_Rn02_00220795 predicted 249
9 SASI_Rn02_00220796 predicted 428
10 SASI_Rn02_00220797 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050193 predicted 591
2 SASI_Mm01_00050194 predicted 434
3 SASI_Mm01_00050195 predicted 481
4 SASI_Mm01_00050196 predicted 295
5 SASI_Mm01_00050197 predicted 500
6 SASI_Mm01_00050199 predicted 367
7 SASI_Mm02_00331315 predicted 306
8 SASI_Mm01_00050200 predicted 364
9 SASI_Mm01_00050201 predicted 295
10 SASI_Mm01_00050202 predicted 372
11 SASI_Mm01_00050198 predicted 728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152321
ERP27 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum protein 27
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152321.2-481s21c1
Sequence:CCGGGGGTTATTCAACAGCGTAATTCTCGAGAATTACGCTGTTGAATAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152321.2-1079s21c1
Sequence:CCGGTCCTCACTCCCTATCCAATTTCTCGAGAAATTGGATAGGGAGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152321.2-503s21c1
Sequence:CCGGAGATTCATCTCCTCCTGATAACTCGAGTTATCAGGAGGAGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152321.2-410s21c1
Sequence:CCGGCCAAATTGAGCCGTTTCATTGCTCGAGCAATGAAACGGCTCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152321.2-351s21c1
Sequence:CCGGCCTGGTAGACAATGAACAACTCTCGAGAGTTGTTCATTGTCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152321.1-386s1c1
Sequence:CCGGGAAAGCATTGATGCCACCAAACTCGAGTTTGGTGGCATCAATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152321.1-1433s1c1
Sequence:CCGGGCAGAAATAGACCATGTGAAACTCGAGTTTCACATGGTCTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152321.1-411s1c1
Sequence:CCGGGCCGTTTCATTGAGATCAACACTCGAGTGTTGATCTCAATGAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152321.1-89s1c1
Sequence:CCGGGAAGTTGAGAAATCCTCAGATCTCGAGATCTGAGGATTTCTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152321.1-409s1c1
Sequence:CCGGGAGCCGTTTCATTGAGATCAACTCGAGTTGATCTCAATGAAACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152321.1-343s1c1
Sequence:CCGGCCTGGTAGACAATGAACAACTCTCGAGAGTTGTTCATTGTCTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152321
ERP27 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum protein 27
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152321.2-481s21c1
Sequence:CCGGGGGTTATTCAACAGCGTAATTCTCGAGAATTACGCTGTTGAATAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152321.2-1079s21c1
Sequence:CCGGTCCTCACTCCCTATCCAATTTCTCGAGAAATTGGATAGGGAGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152321.2-503s21c1
Sequence:CCGGAGATTCATCTCCTCCTGATAACTCGAGTTATCAGGAGGAGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152321.2-410s21c1
Sequence:CCGGCCAAATTGAGCCGTTTCATTGCTCGAGCAATGAAACGGCTCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152321.2-351s21c1
Sequence:CCGGCCTGGTAGACAATGAACAACTCTCGAGAGTTGTTCATTGTCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152321.1-386s1c1
Sequence:CCGGGAAAGCATTGATGCCACCAAACTCGAGTTTGGTGGCATCAATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152321.1-1433s1c1
Sequence:CCGGGCAGAAATAGACCATGTGAAACTCGAGTTTCACATGGTCTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152321.1-411s1c1
Sequence:CCGGGCCGTTTCATTGAGATCAACACTCGAGTGTTGATCTCAATGAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152321.1-89s1c1
Sequence:CCGGGAAGTTGAGAAATCCTCAGATCTCGAGATCTGAGGATTTCTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152321.1-409s1c1
Sequence:CCGGGAGCCGTTTCATTGAGATCAACTCGAGTTGATCTCAATGAAACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152321.1-343s1c1
Sequence:CCGGCCTGGTAGACAATGAACAACTCTCGAGAGTTGTTCATTGTCTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152321
ERP27 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum protein 27
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152321.2-481s21c1
Sequence:CCGGGGGTTATTCAACAGCGTAATTCTCGAGAATTACGCTGTTGAATAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152321.2-1079s21c1
Sequence:CCGGTCCTCACTCCCTATCCAATTTCTCGAGAAATTGGATAGGGAGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152321.2-503s21c1
Sequence:CCGGAGATTCATCTCCTCCTGATAACTCGAGTTATCAGGAGGAGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152321.2-410s21c1
Sequence:CCGGCCAAATTGAGCCGTTTCATTGCTCGAGCAATGAAACGGCTCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152321.2-351s21c1
Sequence:CCGGCCTGGTAGACAATGAACAACTCTCGAGAGTTGTTCATTGTCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152321.1-386s1c1
Sequence:CCGGGAAAGCATTGATGCCACCAAACTCGAGTTTGGTGGCATCAATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152321.1-1433s1c1
Sequence:CCGGGCAGAAATAGACCATGTGAAACTCGAGTTTCACATGGTCTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152321.1-411s1c1
Sequence:CCGGGCCGTTTCATTGAGATCAACACTCGAGTGTTGATCTCAATGAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152321.1-89s1c1
Sequence:CCGGGAAGTTGAGAAATCCTCAGATCTCGAGATCTGAGGATTTCTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152321.1-409s1c1
Sequence:CCGGGAGCCGTTTCATTGAGATCAACTCGAGTTGATCTCAATGAAACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152321.1-343s1c1
Sequence:CCGGCCTGGTAGACAATGAACAACTCTCGAGAGTTGTTCATTGTCTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026983
ERP27 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum protein 27
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-162s21c1
Sequence:CCGGGCACTACCCAGGAACCCATATCTCGAGATATGGGTTCCTGGGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026983.2-674s1c1
Sequence:CCGGGGAAAGGTGATGTCCTATTTCCTCGAGGAAATAGGACATCACCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-506s21c1
Sequence:CCGGATGATTGCAGCTGGCTTATTTCTCGAGAAATAAGCCAGCTGCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-713s21c1
Sequence:CCGGCTGCCAGCTCTGGCCATTTATCTCGAGATAAATGGCCAGAGCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-295s21c1
Sequence:CCGGACGACAGTTCCAAGATGTATCCTCGAGGATACATCTTGGAACTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-674s21c1
Sequence:CCGGGGAAAGGTGATGTCCTATTTCCTCGAGGAAATAGGACATCACCTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026983.1-491s1c1
Sequence:CCGGGACAGAGTACAGTCCTATGATCTCGAGATCATAGGACTGTACTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026983.1-305s1c1
Sequence:CCGGCCAAGATGTATCGTTTGGAATCTCGAGATTCCAAACGATACATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026983.1-244s1c1
Sequence:CCGGGCTTCTTCCAGGATTTAGAAACTCGAGTTTCTAAATCCTGGAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026983
ERP27 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum protein 27
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-162s21c1
Sequence:CCGGGCACTACCCAGGAACCCATATCTCGAGATATGGGTTCCTGGGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026983.2-674s1c1
Sequence:CCGGGGAAAGGTGATGTCCTATTTCCTCGAGGAAATAGGACATCACCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-506s21c1
Sequence:CCGGATGATTGCAGCTGGCTTATTTCTCGAGAAATAAGCCAGCTGCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-713s21c1
Sequence:CCGGCTGCCAGCTCTGGCCATTTATCTCGAGATAAATGGCCAGAGCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-295s21c1
Sequence:CCGGACGACAGTTCCAAGATGTATCCTCGAGGATACATCTTGGAACTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-674s21c1
Sequence:CCGGGGAAAGGTGATGTCCTATTTCCTCGAGGAAATAGGACATCACCTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026983.1-491s1c1
Sequence:CCGGGACAGAGTACAGTCCTATGATCTCGAGATCATAGGACTGTACTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026983.1-305s1c1
Sequence:CCGGCCAAGATGTATCGTTTGGAATCTCGAGATTCCAAACGATACATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026983.1-244s1c1
Sequence:CCGGGCTTCTTCCAGGATTTAGAAACTCGAGTTTCTAAATCCTGGAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026983
ERP27 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum protein 27
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-162s21c1
Sequence:CCGGGCACTACCCAGGAACCCATATCTCGAGATATGGGTTCCTGGGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026983.2-674s1c1
Sequence:CCGGGGAAAGGTGATGTCCTATTTCCTCGAGGAAATAGGACATCACCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-506s21c1
Sequence:CCGGATGATTGCAGCTGGCTTATTTCTCGAGAAATAAGCCAGCTGCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-713s21c1
Sequence:CCGGCTGCCAGCTCTGGCCATTTATCTCGAGATAAATGGCCAGAGCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-295s21c1
Sequence:CCGGACGACAGTTCCAAGATGTATCCTCGAGGATACATCTTGGAACTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026983.2-674s21c1
Sequence:CCGGGGAAAGGTGATGTCCTATTTCCTCGAGGAAATAGGACATCACCTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026983.1-491s1c1
Sequence:CCGGGACAGAGTACAGTCCTATGATCTCGAGATCATAGGACTGTACTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026983.1-305s1c1
Sequence:CCGGCCAAGATGTATCGTTTGGAATCTCGAGATTCCAAACGATACATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026983.1-244s1c1
Sequence:CCGGGCTTCTTCCAGGATTTAGAAACTCGAGTTTCTAAATCCTGGAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks