EMAIL THIS PAGE TO A FRIEND

ERP29

endoplasmic reticulum protein 29

106 Gene Product Result for
Synonyms: C12orf8 ERp28 ERp31 PDI-DB PDIA9
UniProtKB ID: P30040, C9J183, Q3MJC3, Q6FHT4
Gene ID:
Human(10961) Summary: This gene encodes a reticuloplasmin, a protein which resides in the lumen of the endoplasmic reticulum (ER). The protein shows sequence similarity to the protein disulfide isomerase family. However, it lacks the thioredoxin motif characteristic of this family, suggesting that this protein does not function as a disulfide isomerase. The protein dimerizes and is thought to play a role in the processing of secretory proteins within the ER. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(67397) endoplasmic reticulum protein 29
Rat(117030) endoplasmic reticulum protein 29
chicken(416882) endoplasmic reticulum protein 29
domestic cat(101083974) endoplasmic reticulum protein 29
dog(477482) endoplasmic reticulum protein 29
cow(613357) endoplasmic reticulum protein 29
domestic guinea pig(100731699) endoplasmic reticulum protein 29
naked mole-rat(101702986) endoplasmic reticulum protein 29
sheep(100145868) endoplasmic reticulum protein 29
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026129 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026129 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026129 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006817 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034025 Rosetta Predictions human pricing
NM_006817 Rosetta Predictions human pricing
NM_053961 Rosetta Predictions rat pricing
NM_026129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152784 predicted 571
2 SASI_Hs01_00152783 predicted 693
3 SASI_Hs01_00152787 predicted 247
4 SASI_Hs01_00152789 predicted 232
5 SASI_Hs02_00308124 predicted 289
6 SASI_Hs01_00152791 predicted 532
7 SASI_Hs02_00308125 predicted 232
8 SASI_Hs01_00152785 predicted 265
9 SASI_Hs01_00152786 predicted 381
10 SASI_Hs02_00308126 predicted 275
11 SASI_Hs01_00152788 predicted 446
12 SASI_Hs01_00152790 predicted 648
13 SASI_Hs01_00152792 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050840 predicted 1205
2 SASI_Hs01_00050841 predicted 1177
3 SASI_Hs01_00050843 predicted 1174
4 SASI_Hs01_00050845 predicted 1161
5 SASI_Hs01_00050846 predicted 943
6 SASI_Hs01_00050847 predicted 1112
7 SASI_Hs01_00050848 predicted 1189
8 SASI_Hs01_00050842 predicted 1187
9 SASI_Hs01_00050849 predicted 1187
10 SASI_Hs02_00342361 predicted 829
11 SASI_Hs01_00050844 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266924 predicted 680
2 SASI_Rn02_00266925 predicted 411
3 SASI_Rn02_00266926 predicted 607
4 SASI_Rn02_00266927 predicted 384
5 SASI_Rn02_00266928 predicted 478
6 SASI_Rn02_00266929 predicted 205
7 SASI_Rn02_00266930 predicted 765
8 SASI_Rn02_00266931 predicted 680
9 SASI_Rn02_00266932 predicted 291
10 SASI_Rn02_00266933 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184826 predicted 719
2 SASI_Mm02_00329715 predicted 778
3 SASI_Mm01_00184827 predicted 765
4 SASI_Mm01_00184828 predicted 538
5 SASI_Mm01_00184829 predicted 427
6 SASI_Mm01_00184830 predicted 1012
7 SASI_Mm01_00184831 predicted 296
8 SASI_Mm02_00329716 predicted 478
9 SASI_Mm01_00184833 predicted 853
10 SASI_Mm01_00184834 predicted 552
11 SASI_Mm01_00184832 predicted 954
12 SASI_Mm01_00184835 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026129
VALIDATED
ERP29 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum protein 29
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026129.2-1074s1c1
Sequence:CCGGGCTGAGATCATACTTAGGACACTCGAGTGTCCTAAGTATGATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026129.2-827s1c1
Sequence:CCGGGAACAAGATGAGTGACAGCAACTCGAGTTGCTGTCACTCATCTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026129.2-416s1c1
Sequence:CCGGGATCTCAGACTATGGCGACAACTCGAGTTGTCGCCATAGTCTGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026129.2-482s1c1
Sequence:CCGGCTACCCAGTCTTCTACCTATTCTCGAGAATAGGTAGAAGACTGGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026129.2-700s1c1
Sequence:CCGGGCCTCCTAAGTGTGAAGGAAACTCGAGTTTCCTTCACACTTAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026129.2-271s21c1
Sequence:CCGGTCACTTTCTACAAGGTCATTCCTCGAGGAATGACCTTGTAGAAAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026129.2-769s21c1
Sequence:CCGGTGGACCAAGGTGAGGACTTTCCTCGAGGAAAGTCCTCACCTTGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026129.2-482s21c1
Sequence:CCGGCTACCCAGTCTTCTACCTATTCTCGAGAATAGGTAGAAGACTGGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026129.2-1074s21c1
Sequence:CCGGGCTGAGATCATACTTAGGACACTCGAGTGTCCTAAGTATGATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026129.2-855s21c1
Sequence:CCGGGAGCTACAGAAGAGCTTAAACCTCGAGGTTTAAGCTCTTCTGTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026129
VALIDATED
ERP29 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum protein 29
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026129.2-1074s1c1
Sequence:CCGGGCTGAGATCATACTTAGGACACTCGAGTGTCCTAAGTATGATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026129.2-827s1c1
Sequence:CCGGGAACAAGATGAGTGACAGCAACTCGAGTTGCTGTCACTCATCTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026129.2-416s1c1
Sequence:CCGGGATCTCAGACTATGGCGACAACTCGAGTTGTCGCCATAGTCTGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026129.2-482s1c1
Sequence:CCGGCTACCCAGTCTTCTACCTATTCTCGAGAATAGGTAGAAGACTGGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026129.2-700s1c1
Sequence:CCGGGCCTCCTAAGTGTGAAGGAAACTCGAGTTTCCTTCACACTTAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026129.2-271s21c1
Sequence:CCGGTCACTTTCTACAAGGTCATTCCTCGAGGAATGACCTTGTAGAAAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026129.2-769s21c1
Sequence:CCGGTGGACCAAGGTGAGGACTTTCCTCGAGGAAAGTCCTCACCTTGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026129.2-482s21c1
Sequence:CCGGCTACCCAGTCTTCTACCTATTCTCGAGAATAGGTAGAAGACTGGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026129.2-1074s21c1
Sequence:CCGGGCTGAGATCATACTTAGGACACTCGAGTGTCCTAAGTATGATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026129.2-855s21c1
Sequence:CCGGGAGCTACAGAAGAGCTTAAACCTCGAGGTTTAAGCTCTTCTGTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026129
VALIDATED
ERP29 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum protein 29
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026129.2-1074s1c1
Sequence:CCGGGCTGAGATCATACTTAGGACACTCGAGTGTCCTAAGTATGATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026129.2-827s1c1
Sequence:CCGGGAACAAGATGAGTGACAGCAACTCGAGTTGCTGTCACTCATCTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026129.2-416s1c1
Sequence:CCGGGATCTCAGACTATGGCGACAACTCGAGTTGTCGCCATAGTCTGAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026129.2-482s1c1
Sequence:CCGGCTACCCAGTCTTCTACCTATTCTCGAGAATAGGTAGAAGACTGGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026129.2-700s1c1
Sequence:CCGGGCCTCCTAAGTGTGAAGGAAACTCGAGTTTCCTTCACACTTAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026129.2-271s21c1
Sequence:CCGGTCACTTTCTACAAGGTCATTCCTCGAGGAATGACCTTGTAGAAAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026129.2-769s21c1
Sequence:CCGGTGGACCAAGGTGAGGACTTTCCTCGAGGAAAGTCCTCACCTTGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026129.2-482s21c1
Sequence:CCGGCTACCCAGTCTTCTACCTATTCTCGAGAATAGGTAGAAGACTGGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026129.2-1074s21c1
Sequence:CCGGGCTGAGATCATACTTAGGACACTCGAGTGTCCTAAGTATGATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026129.2-855s21c1
Sequence:CCGGGAGCTACAGAAGAGCTTAAACCTCGAGGTTTAAGCTCTTCTGTAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006817
VALIDATED
ERP29 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum protein 29
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-731s1c1
Sequence:CCGGGCTCCAGAAGAGCTTAAACATCTCGAGATGTTTAAGCTCTTCTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-170s1c1
Sequence:CCGGCAAGTTCGTCTTGGTGAAGTTCTCGAGAACTTCACCAAGACGAACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-701s1c1
Sequence:CCGGGAACAAGATGAGTGACGGCAACTCGAGTTGCCGTCACTCATCTTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-607s1c1
Sequence:CCGGCCGAGCAATACCTGAAGATCACTCGAGTGATCTTCAGGTATTGCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-287s1c1
Sequence:CCGGGATCTCAGATTATGGTGACAACTCGAGTTGTCACCATAATCTGAGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006817.3-970s21c1
Sequence:CCGGTGAGTCCCTTGTGGAATATAACTCGAGTTATATTCCACAAGGGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006817.3-1139s21c1
Sequence:CCGGCAGAAGGAATGAGTGCTATAGCTCGAGCTATAGCACTCATTCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006817.3-885s21c1
Sequence:CCGGCCGAGAAAGAGGAGCTGTAAACTCGAGTTTACAGCTCCTCTTTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006817.3-787s21c1
Sequence:CCGGGATCGCCAGGCTGATTGAGAACTCGAGTTCTCAATCAGCCTGGCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006817
VALIDATED
ERP29 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum protein 29
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-731s1c1
Sequence:CCGGGCTCCAGAAGAGCTTAAACATCTCGAGATGTTTAAGCTCTTCTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-170s1c1
Sequence:CCGGCAAGTTCGTCTTGGTGAAGTTCTCGAGAACTTCACCAAGACGAACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-701s1c1
Sequence:CCGGGAACAAGATGAGTGACGGCAACTCGAGTTGCCGTCACTCATCTTGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-607s1c1
Sequence:CCGGCCGAGCAATACCTGAAGATCACTCGAGTGATCTTCAGGTATTGCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-287s1c1
Sequence:CCGGGATCTCAGATTATGGTGACAACTCGAGTTGTCACCATAATCTGAGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006817.3-970s21c1
Sequence:CCGGTGAGTCCCTTGTGGAATATAACTCGAGTTATATTCCACAAGGGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006817.3-1139s21c1
Sequence:CCGGCAGAAGGAATGAGTGCTATAGCTCGAGCTATAGCACTCATTCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006817.3-885s21c1
Sequence:CCGGCCGAGAAAGAGGAGCTGTAAACTCGAGTTTACAGCTCCTCTTTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006817.3-787s21c1
Sequence:CCGGGATCGCCAGGCTGATTGAGAACTCGAGTTCTCAATCAGCCTGGCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006817
VALIDATED
ERP29 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum protein 29
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-731s1c1
Sequence:CCGGGCTCCAGAAGAGCTTAAACATCTCGAGATGTTTAAGCTCTTCTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-170s1c1
Sequence:CCGGCAAGTTCGTCTTGGTGAAGTTCTCGAGAACTTCACCAAGACGAACTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-701s1c1
Sequence:CCGGGAACAAGATGAGTGACGGCAACTCGAGTTGCCGTCACTCATCTTGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-607s1c1
Sequence:CCGGCCGAGCAATACCTGAAGATCACTCGAGTGATCTTCAGGTATTGCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006817.2-287s1c1
Sequence:CCGGGATCTCAGATTATGGTGACAACTCGAGTTGTCACCATAATCTGAGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006817.3-970s21c1
Sequence:CCGGTGAGTCCCTTGTGGAATATAACTCGAGTTATATTCCACAAGGGACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006817.3-1139s21c1
Sequence:CCGGCAGAAGGAATGAGTGCTATAGCTCGAGCTATAGCACTCATTCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006817.3-885s21c1
Sequence:CCGGCCGAGAAAGAGGAGCTGTAAACTCGAGTTTACAGCTCCTCTTTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006817.3-787s21c1
Sequence:CCGGGATCGCCAGGCTGATTGAGAACTCGAGTTCTCAATCAGCCTGGCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)