EMAIL THIS PAGE TO A FRIEND

ERP44

endoplasmic reticulum protein 44

155 Gene Product Result for
Synonyms: PDIA10 TXNDC4
UniProtKB ID: Q9BS26, O60319, Q4VXC1, Q5VWZ7, Q6UW14, Q8WX67
Gene ID:
Mouse(76299) endoplasmic reticulum protein 44
Rat(298066) endoplasmic reticulum protein 44
Zebrafish(393866) endoplasmic reticulum protein 44
domestic cat(101094548) endoplasmic reticulum protein 44
dog(474781) endoplasmic reticulum protein 44
chicken(420994) endoplasmic reticulum protein 44
cow(506157) endoplasmic reticulum protein 44
sheep(101122251) endoplasmic reticulum protein 44
naked mole-rat(101711387) endoplasmic reticulum protein 44
domestic guinea pig(100716079) endoplasmic reticulum protein 44
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_376898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376898 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144031 MISSION® esiRNA esiRNA human ERP44 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015051 Rosetta Predictions human pricing
NM_001008317 Rosetta Predictions rat pricing
XM_579186 Rosetta Predictions rat pricing
NM_029572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239622 predicted 380
2 SASI_Hs01_00239624 predicted 457
3 SASI_Hs01_00239625 predicted 643
4 SASI_Hs01_00239626 predicted 1049
5 SASI_Hs01_00239627 predicted 996
6 SASI_Hs01_00239628 predicted 759
7 SASI_Hs01_00239629 predicted 514
8 SASI_Hs01_00239631 predicted 1181
9 SASI_Hs02_00346897 predicted 1212
10 SASI_Hs02_00346898 predicted 1163
11 SASI_Hs01_00239623 predicted 1025
12 SASI_Hs01_00239630 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083693 predicted 1139
2 SASI_Rn01_00083694 predicted 322
3 SASI_Rn01_00083695 predicted 1065
4 SASI_Rn02_00199054 predicted 584
5 SASI_Rn01_00083696 predicted 689
6 SASI_Rn01_00083697 predicted 676
7 SASI_Rn01_00083698 predicted 1102
8 SASI_Rn01_00083699 predicted 978
9 SASI_Rn01_00083700 predicted 1032
10 SASI_Rn01_00083701 predicted 885
11 SASI_Rn01_00083692 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143886 predicted 510
2 SASI_Rn01_00143887 predicted 325
3 SASI_Rn01_00143888 predicted 1068
4 SASI_Rn01_00143889 predicted 585
5 SASI_Rn01_00143890 predicted 688
6 SASI_Rn01_00143891 predicted 683
7 SASI_Rn01_00143892 predicted 1046
8 SASI_Rn01_00143893 predicted 977
9 SASI_Rn01_00143894 predicted 1041
10 SASI_Rn01_00143895 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107928 predicted 845
2 SASI_Mm01_00107929 predicted 583
3 SASI_Mm01_00107930 predicted 1150
4 SASI_Mm01_00107931 predicted 400
5 SASI_Mm01_00107932 predicted 325
6 SASI_Mm01_00107933 predicted 1141
7 SASI_Mm01_00107934 predicted 1104
8 SASI_Mm01_00107935 predicted 753
9 SASI_Mm01_00107936 predicted 1053
10 SASI_Mm01_00107937 predicted 948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029572
VALIDATED
ERP44 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum protein 44
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029572.2-571s21c1
Sequence:CCGGGTAACCCAGTCCACGAGATTCCTCGAGGAATCTCGTGGACTGGGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029572.2-609s21c1
Sequence:CCGGACCAATCTTGATCGCAGTAAGCTCGAGCTTACTGCGATCAAGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029572.2-1324s21c1
Sequence:CCGGCCAGCGAGTATAGGTATACTTCTCGAGAAGTATACCTATACTCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029572.2-1000s21c1
Sequence:CCGGCCCGGCAGTTGATAAGTGAAACTCGAGTTTCACTTATCAACTGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029572.2-1419s21c1
Sequence:CCGGGTGGAAATAGTGAACCTATATCTCGAGATATAGGTTCACTATTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029572.1-1388s1c1
Sequence:CCGGGTGGAAATAGTGAACCTATATCTCGAGATATAGGTTCACTATTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029572.1-969s1c1
Sequence:CCGGCCCGGCAGTTGATAAGTGAAACTCGAGTTTCACTTATCAACTGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029572.1-333s1c1
Sequence:CCGGCTGATGTCATTAAGGAAGAATCTCGAGATTCTTCCTTAATGACATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029572.1-1293s1c1
Sequence:CCGGCCAGCGAGTATAGGTATACTTCTCGAGAAGTATACCTATACTCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029572
VALIDATED
ERP44 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum protein 44
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029572.2-571s21c1
Sequence:CCGGGTAACCCAGTCCACGAGATTCCTCGAGGAATCTCGTGGACTGGGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029572.2-609s21c1
Sequence:CCGGACCAATCTTGATCGCAGTAAGCTCGAGCTTACTGCGATCAAGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029572.2-1324s21c1
Sequence:CCGGCCAGCGAGTATAGGTATACTTCTCGAGAAGTATACCTATACTCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029572.2-1000s21c1
Sequence:CCGGCCCGGCAGTTGATAAGTGAAACTCGAGTTTCACTTATCAACTGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029572.2-1419s21c1
Sequence:CCGGGTGGAAATAGTGAACCTATATCTCGAGATATAGGTTCACTATTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029572.1-1388s1c1
Sequence:CCGGGTGGAAATAGTGAACCTATATCTCGAGATATAGGTTCACTATTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029572.1-969s1c1
Sequence:CCGGCCCGGCAGTTGATAAGTGAAACTCGAGTTTCACTTATCAACTGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029572.1-333s1c1
Sequence:CCGGCTGATGTCATTAAGGAAGAATCTCGAGATTCTTCCTTAATGACATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029572.1-1293s1c1
Sequence:CCGGCCAGCGAGTATAGGTATACTTCTCGAGAAGTATACCTATACTCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029572
VALIDATED
ERP44 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum protein 44
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029572.2-571s21c1
Sequence:CCGGGTAACCCAGTCCACGAGATTCCTCGAGGAATCTCGTGGACTGGGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029572.2-609s21c1
Sequence:CCGGACCAATCTTGATCGCAGTAAGCTCGAGCTTACTGCGATCAAGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029572.2-1324s21c1
Sequence:CCGGCCAGCGAGTATAGGTATACTTCTCGAGAAGTATACCTATACTCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029572.2-1000s21c1
Sequence:CCGGCCCGGCAGTTGATAAGTGAAACTCGAGTTTCACTTATCAACTGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029572.2-1419s21c1
Sequence:CCGGGTGGAAATAGTGAACCTATATCTCGAGATATAGGTTCACTATTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029572.1-1388s1c1
Sequence:CCGGGTGGAAATAGTGAACCTATATCTCGAGATATAGGTTCACTATTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029572.1-969s1c1
Sequence:CCGGCCCGGCAGTTGATAAGTGAAACTCGAGTTTCACTTATCAACTGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029572.1-333s1c1
Sequence:CCGGCTGATGTCATTAAGGAAGAATCTCGAGATTCTTCCTTAATGACATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029572.1-1293s1c1
Sequence:CCGGCCAGCGAGTATAGGTATACTTCTCGAGAAGTATACCTATACTCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376898
VALIDATED
ERP44 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum protein 44
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376898.1-1522s1c1
Sequence:CCGGGCACCCAGTGAATATAGGTATCTCGAGATACCTATATTCACTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376898.1-1201s1c1
Sequence:CCGGGCTCGGCAATTAATAAGTGAACTCGAGTTCACTTATTAATTGCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376898.1-566s1c1
Sequence:CCGGCCGATGTCATTAAGGAAGAATCTCGAGATTCTTCCTTAATGACATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376898.1-446s1c1
Sequence:CCGGCAAGTCTTGATACAGAGAATACTCGAGTATTCTCTGTATCAAGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376898.1-1270s1c1
Sequence:CCGGCCTCTTCTGCACATACAGAAACTCGAGTTTCTGTATGTGCAGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376898
VALIDATED
ERP44 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum protein 44
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376898.1-1522s1c1
Sequence:CCGGGCACCCAGTGAATATAGGTATCTCGAGATACCTATATTCACTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376898.1-1201s1c1
Sequence:CCGGGCTCGGCAATTAATAAGTGAACTCGAGTTCACTTATTAATTGCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376898.1-566s1c1
Sequence:CCGGCCGATGTCATTAAGGAAGAATCTCGAGATTCTTCCTTAATGACATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376898.1-446s1c1
Sequence:CCGGCAAGTCTTGATACAGAGAATACTCGAGTATTCTCTGTATCAAGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376898.1-1270s1c1
Sequence:CCGGCCTCTTCTGCACATACAGAAACTCGAGTTTCTGTATGTGCAGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376898
VALIDATED
ERP44 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum protein 44
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376898.1-1522s1c1
Sequence:CCGGGCACCCAGTGAATATAGGTATCTCGAGATACCTATATTCACTGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376898.1-1201s1c1
Sequence:CCGGGCTCGGCAATTAATAAGTGAACTCGAGTTCACTTATTAATTGCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376898.1-566s1c1
Sequence:CCGGCCGATGTCATTAAGGAAGAATCTCGAGATTCTTCCTTAATGACATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376898.1-446s1c1
Sequence:CCGGCAAGTCTTGATACAGAGAATACTCGAGTATTCTCTGTATCAAGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376898.1-1270s1c1
Sequence:CCGGCCTCTTCTGCACATACAGAAACTCGAGTTTCTGTATGTGCAGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)