EMAIL THIS PAGE TO A FRIEND

ERRFI1

ERBB receptor feedback inhibitor 1

97 Gene Product Result for
Synonyms: GENE-33 MIG-6 MIG6 RALT
UniProtKB ID: Q9UJM3, B2RDX9, Q9NTG9, Q9UD05
Gene ID:
Human(54206) Summary: ERRFI1 is a cytoplasmic protein whose expression is upregulated with cell growth (Wick et al., 1995 [PubMed 7641805]
Mouse(74155) ERBB receptor feedback inhibitor 1
Rat(313729) ERBB receptor feedback inhibitor 1
Zebrafish(798009) ERBB receptor feedback inhibitor 1
chicken(419364) ERBB receptor feedback inhibitor 1
dog(489636) ERBB receptor feedback inhibitor 1
domestic cat(101093119) ERBB receptor feedback inhibitor 1
cow(516303) ERBB receptor feedback inhibitor 1
Horse(100052062) ERBB receptor feedback inhibitor 1
sheep(101115142) ERBB receptor feedback inhibitor 1
domestic guinea pig(100722730) ERBB receptor feedback inhibitor 1
naked mole-rat(101722748) ERBB receptor feedback inhibitor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018948 Rosetta Predictions human pricing
NM_001014071 Rosetta Predictions rat pricing
NM_133753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133579 predicted 1322
2 SASI_Hs01_00133581 predicted 533
3 SASI_Hs01_00133582 predicted 1338
4 SASI_Hs02_00352414 predicted 819
5 SASI_Hs01_00133584 predicted 1372
6 SASI_Hs01_00133585 predicted 1500
7 SASI_Hs01_00133586 predicted 1364
8 SASI_Hs02_00352415 predicted 1326
9 SASI_Hs01_00133587 predicted 1169
10 SASI_Hs01_00133588 predicted 1124
11 SASI_Hs01_00133580 predicted 770
12 SASI_Hs01_00133583 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079111 predicted 867
2 SASI_Rn01_00079112 predicted 1454
3 SASI_Rn01_00079113 predicted 716
4 SASI_Rn01_00079114 predicted 582
5 SASI_Rn01_00079115 predicted 401
6 SASI_Rn01_00079116 predicted 289
7 SASI_Rn01_00079117 predicted 1426
8 SASI_Rn01_00079118 predicted 1171
9 SASI_Rn01_00079119 predicted 1162
10 SASI_Rn02_00201475 predicted 1653
11 SASI_Rn01_00079110 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145026 predicted 1653
2 SASI_Mm01_00145027 predicted 392
3 SASI_Mm01_00145028 predicted 272
4 SASI_Mm01_00145029 predicted 1215
5 SASI_Mm01_00145030 predicted 1692
6 SASI_Mm01_00145031 predicted 1409
7 SASI_Mm01_00145032 predicted 571
8 SASI_Mm01_00145033 predicted 1141
9 SASI_Mm01_00145034 predicted 1664
10 SASI_Mm01_00145035 predicted 560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018948
VALIDATED
ERRFI1 MISSION shRNA Bacterial Glycerol Stock
ERBB receptor feedback inhibitor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018948.2-2256s1c1
Sequence:CCGGGCAGGTTACTTGGCAACCATACTCGAGTATGGTTGCCAAGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018948.2-942s1c1
Sequence:CCGGCGAAGATTAAGAAGGTCTCATCTCGAGATGAGACCTTCTTAATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018948.2-1084s1c1
Sequence:CCGGCTAGACCAGTAAAGCCAGATTCTCGAGAATCTGGCTTTACTGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018948.2-1413s1c1
Sequence:CCGGCCACCATACCTGGACAAATATCTCGAGATATTTGTCCAGGTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018948.2-1329s1c1
Sequence:CCGGGCCAGTAAGGTTCCTTGCATTCTCGAGAATGCAAGGAACCTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018948.3-1450s21c1
Sequence:CCGGCCACCATACCTGGACAAATATCTCGAGATATTTGTCCAGGTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018948.3-2293s21c1
Sequence:CCGGGCAGGTTACTTGGCAACCATACTCGAGTATGGTTGCCAAGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018948.3-1121s21c1
Sequence:CCGGCTAGACCAGTAAAGCCAGATTCTCGAGAATCTGGCTTTACTGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018948.3-1366s21c1
Sequence:CCGGGCCAGTAAGGTTCCTTGCATTCTCGAGAATGCAAGGAACCTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018948
VALIDATED
ERRFI1 MISSION shRNA shRNA Plasmid DNA
ERBB receptor feedback inhibitor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018948.2-2256s1c1
Sequence:CCGGGCAGGTTACTTGGCAACCATACTCGAGTATGGTTGCCAAGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018948.2-942s1c1
Sequence:CCGGCGAAGATTAAGAAGGTCTCATCTCGAGATGAGACCTTCTTAATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018948.2-1084s1c1
Sequence:CCGGCTAGACCAGTAAAGCCAGATTCTCGAGAATCTGGCTTTACTGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018948.2-1413s1c1
Sequence:CCGGCCACCATACCTGGACAAATATCTCGAGATATTTGTCCAGGTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018948.2-1329s1c1
Sequence:CCGGGCCAGTAAGGTTCCTTGCATTCTCGAGAATGCAAGGAACCTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018948.3-1450s21c1
Sequence:CCGGCCACCATACCTGGACAAATATCTCGAGATATTTGTCCAGGTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018948.3-2293s21c1
Sequence:CCGGGCAGGTTACTTGGCAACCATACTCGAGTATGGTTGCCAAGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018948.3-1121s21c1
Sequence:CCGGCTAGACCAGTAAAGCCAGATTCTCGAGAATCTGGCTTTACTGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018948.3-1366s21c1
Sequence:CCGGGCCAGTAAGGTTCCTTGCATTCTCGAGAATGCAAGGAACCTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018948
VALIDATED
ERRFI1 MISSION shRNA Lentiviral Transduction Particles
ERBB receptor feedback inhibitor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018948.2-2256s1c1
Sequence:CCGGGCAGGTTACTTGGCAACCATACTCGAGTATGGTTGCCAAGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018948.2-942s1c1
Sequence:CCGGCGAAGATTAAGAAGGTCTCATCTCGAGATGAGACCTTCTTAATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018948.2-1084s1c1
Sequence:CCGGCTAGACCAGTAAAGCCAGATTCTCGAGAATCTGGCTTTACTGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018948.2-1413s1c1
Sequence:CCGGCCACCATACCTGGACAAATATCTCGAGATATTTGTCCAGGTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018948.2-1329s1c1
Sequence:CCGGGCCAGTAAGGTTCCTTGCATTCTCGAGAATGCAAGGAACCTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018948.3-1450s21c1
Sequence:CCGGCCACCATACCTGGACAAATATCTCGAGATATTTGTCCAGGTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018948.3-2293s21c1
Sequence:CCGGGCAGGTTACTTGGCAACCATACTCGAGTATGGTTGCCAAGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018948.3-1121s21c1
Sequence:CCGGCTAGACCAGTAAAGCCAGATTCTCGAGAATCTGGCTTTACTGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018948.3-1366s21c1
Sequence:CCGGGCCAGTAAGGTTCCTTGCATTCTCGAGAATGCAAGGAACCTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133753
VALIDATED
ERRFI1 MISSION shRNA Bacterial Glycerol Stock
ERBB receptor feedback inhibitor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133753.1-1748s1c1
Sequence:CCGGCCGCCTTAATGAGAAAGGCTTCTCGAGAAGCCTTTCTCATTAAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133753.1-866s1c1
Sequence:CCGGCGGCCAGATCAACTATGCATACTCGAGTATGCATAGTTGATCTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133753.1-816s1c1
Sequence:CCGGCCTTCAGATTTCAAATACGATCTCGAGATCGTATTTGAAATCTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133753.1-1317s1c1
Sequence:CCGGCCCAAGTATGTCAGCAGCAAACTCGAGTTTGCTGCTGACATACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133753.1-1452s1c1
Sequence:CCGGCCACCGTACCTGGACAAATATCTCGAGATATTTGTCCAGGTACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133753.1-2092s21c1
Sequence:CCGGCATACAGGCCTGCTCTATAAACTCGAGTTTATAGAGCAGGCCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133753.1-1380s21c1
Sequence:CCGGCCTTGCATCCTGCCCATTATTCTCGAGAATAATGGGCAGGATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133753.1-1414s21c1
Sequence:CCGGAGGTTAGCTCAACGCATTATTCTCGAGAATAATGCGTTGAGCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133753.1-566s21c1
Sequence:CCGGGCGTGAAGAGGATCAAGTTATCTCGAGATAACTTGATCCTCTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133753.1-1452s21c1
Sequence:CCGGCCACCGTACCTGGACAAATATCTCGAGATATTTGTCCAGGTACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133753
VALIDATED
ERRFI1 MISSION shRNA shRNA Plasmid DNA
ERBB receptor feedback inhibitor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133753.1-1748s1c1
Sequence:CCGGCCGCCTTAATGAGAAAGGCTTCTCGAGAAGCCTTTCTCATTAAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133753.1-866s1c1
Sequence:CCGGCGGCCAGATCAACTATGCATACTCGAGTATGCATAGTTGATCTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133753.1-816s1c1
Sequence:CCGGCCTTCAGATTTCAAATACGATCTCGAGATCGTATTTGAAATCTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133753.1-1317s1c1
Sequence:CCGGCCCAAGTATGTCAGCAGCAAACTCGAGTTTGCTGCTGACATACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133753.1-1452s1c1
Sequence:CCGGCCACCGTACCTGGACAAATATCTCGAGATATTTGTCCAGGTACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133753.1-2092s21c1
Sequence:CCGGCATACAGGCCTGCTCTATAAACTCGAGTTTATAGAGCAGGCCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133753.1-1380s21c1
Sequence:CCGGCCTTGCATCCTGCCCATTATTCTCGAGAATAATGGGCAGGATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133753.1-1414s21c1
Sequence:CCGGAGGTTAGCTCAACGCATTATTCTCGAGAATAATGCGTTGAGCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133753.1-566s21c1
Sequence:CCGGGCGTGAAGAGGATCAAGTTATCTCGAGATAACTTGATCCTCTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133753.1-1452s21c1
Sequence:CCGGCCACCGTACCTGGACAAATATCTCGAGATATTTGTCCAGGTACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133753
VALIDATED
ERRFI1 MISSION shRNA Lentiviral Transduction Particles
ERBB receptor feedback inhibitor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133753.1-1748s1c1
Sequence:CCGGCCGCCTTAATGAGAAAGGCTTCTCGAGAAGCCTTTCTCATTAAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133753.1-866s1c1
Sequence:CCGGCGGCCAGATCAACTATGCATACTCGAGTATGCATAGTTGATCTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133753.1-816s1c1
Sequence:CCGGCCTTCAGATTTCAAATACGATCTCGAGATCGTATTTGAAATCTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133753.1-1317s1c1
Sequence:CCGGCCCAAGTATGTCAGCAGCAAACTCGAGTTTGCTGCTGACATACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133753.1-1452s1c1
Sequence:CCGGCCACCGTACCTGGACAAATATCTCGAGATATTTGTCCAGGTACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133753.1-2092s21c1
Sequence:CCGGCATACAGGCCTGCTCTATAAACTCGAGTTTATAGAGCAGGCCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133753.1-1380s21c1
Sequence:CCGGCCTTGCATCCTGCCCATTATTCTCGAGAATAATGGGCAGGATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133753.1-1414s21c1
Sequence:CCGGAGGTTAGCTCAACGCATTATTCTCGAGAATAATGCGTTGAGCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133753.1-566s21c1
Sequence:CCGGGCGTGAAGAGGATCAAGTTATCTCGAGATAACTTGATCCTCTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133753.1-1452s21c1
Sequence:CCGGCCACCGTACCTGGACAAATATCTCGAGATATTTGTCCAGGTACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks