EMAIL THIS PAGE TO A FRIEND

ERV3-1

endogenous retrovirus group 3, member 1

4 Gene Product Result for
Synonyms: ERV-R ERV3 ERVR HERV-R HERVR envR
Species: Human ERV3-1(2086)
UniProtKB ID: Q14264
Gene ID:
Human(2086) Summary: The human genome includes many retroelements including the human endogenous retroviruses (HERVs). ERV3, one of the most studied HERVs, is thought to have integrated 30 to 40 million years ago and is present in higher primates with the exception of gorillas. Taken together, the observation of genome conservation, the detection of transcript expression, and the presence of conserved ORFs is circumstantial evidence for a functional role. A functional role is also suggested by the observation that downregulation of ERV3 is reported in choriocarcinoma. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302713 ANTI-ERV3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007253 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007253
ERV3-1 MISSION shRNA Bacterial Glycerol Stock
endogenous retrovirus group 3, member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-1146s1c1
Sequence:CCGGGCCACAAGCATATCGACAACTCTCGAGAGTTGTCGATATGCTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007253.1-218s1c1
Sequence:CCGGGCAAGGATGTCGTATCCTTATCTCGAGATAAGGATACGACATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-1420s1c1
Sequence:CCGGCGCATTATAAGATTGCAGGCACTCGAGTGCCTGCAATCTTATAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-59s1c1
Sequence:CCGGCTTGTACTCACAACCAGACAACTCGAGTTGTCTGGTTGTGAGTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-571s1c1
Sequence:CCGGCCAGGAGCCTATGTCTATCTACTCGAGTAGATAGACATAGGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-269s1c1
Sequence:CCGGGCTCACTCTTTCCCGTAATCTCTCGAGAGATTACGGGAAAGAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007253
ERV3-1 MISSION shRNA shRNA Plasmid DNA
endogenous retrovirus group 3, member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-1146s1c1
Sequence:CCGGGCCACAAGCATATCGACAACTCTCGAGAGTTGTCGATATGCTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007253.1-218s1c1
Sequence:CCGGGCAAGGATGTCGTATCCTTATCTCGAGATAAGGATACGACATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-1420s1c1
Sequence:CCGGCGCATTATAAGATTGCAGGCACTCGAGTGCCTGCAATCTTATAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-59s1c1
Sequence:CCGGCTTGTACTCACAACCAGACAACTCGAGTTGTCTGGTTGTGAGTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-571s1c1
Sequence:CCGGCCAGGAGCCTATGTCTATCTACTCGAGTAGATAGACATAGGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-269s1c1
Sequence:CCGGGCTCACTCTTTCCCGTAATCTCTCGAGAGATTACGGGAAAGAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007253
ERV3-1 MISSION shRNA Lentiviral Transduction Particles
endogenous retrovirus group 3, member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-1146s1c1
Sequence:CCGGGCCACAAGCATATCGACAACTCTCGAGAGTTGTCGATATGCTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007253.1-218s1c1
Sequence:CCGGGCAAGGATGTCGTATCCTTATCTCGAGATAAGGATACGACATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-1420s1c1
Sequence:CCGGCGCATTATAAGATTGCAGGCACTCGAGTGCCTGCAATCTTATAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-59s1c1
Sequence:CCGGCTTGTACTCACAACCAGACAACTCGAGTTGTCTGGTTGTGAGTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-571s1c1
Sequence:CCGGCCAGGAGCCTATGTCTATCTACTCGAGTAGATAGACATAGGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007253.1-269s1c1
Sequence:CCGGGCTCACTCTTTCCCGTAATCTCTCGAGAGATTACGGGAAAGAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks