EMAIL THIS PAGE TO A FRIEND

ERVFC1-1

endogenous retrovirus group FC1, member 1

50 Gene Product Result for
Synonyms: envF(c)2
Species: Human ERVFC1-1(346547)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207367 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207367 Rosetta Predictions human pricing
XR_040030 Rosetta Predictions human pricing
XR_040031 Rosetta Predictions human pricing
XR_040032 Rosetta Predictions human pricing
XR_040033 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080535 predicted 1140
2 SASI_Hs01_00080536 predicted 1196
3 SASI_Hs01_00080537 predicted 1237
4 SASI_Hs01_00080538 predicted 1123
5 SASI_Hs01_00080539 predicted 738
6 SASI_Hs01_00080540 predicted 1266
7 SASI_Hs01_00080541 predicted 803
8 SASI_Hs01_00080542 predicted 1047
9 SASI_Hs01_00080543 predicted 1333
10 SASI_Hs01_00080544 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515313 predicted 800
2 SASI_Hs02_00515314 predicted 785
3 SASI_Hs02_00515315 predicted 1090
4 SASI_Hs02_00515316 predicted 754
5 SASI_Hs02_00515317 predicted 1091
6 SASI_Hs02_00515318 predicted 973
7 SASI_Hs02_00515319 predicted 755
8 SASI_Hs02_00515320 predicted 1043
9 SASI_Hs02_00515321 predicted 977
10 SASI_Hs02_00515322 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515323 predicted 291
2 SASI_Hs02_00515324 predicted 453
3 SASI_Hs02_00515325 predicted 837
4 SASI_Hs02_00515326 predicted 771
5 SASI_Hs02_00515327 predicted 1087
6 SASI_Hs02_00515328 predicted 832
7 SASI_Hs02_00515329 predicted 786
8 SASI_Hs02_00515330 predicted 823
9 SASI_Hs02_00515331 predicted 744
10 SASI_Hs02_00515332 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515333 predicted 1411
2 SASI_Hs02_00515334 predicted 992
3 SASI_Hs02_00515335 predicted 1410
4 SASI_Hs02_00515336 predicted 959
5 SASI_Hs02_00515337 predicted 1124
6 SASI_Hs02_00515338 predicted 1323
7 SASI_Hs02_00515339 predicted 1265
8 SASI_Hs02_00515340 predicted 1504
9 SASI_Hs02_00515341 predicted 1497
10 SASI_Hs02_00515342 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515343 predicted 287
2 SASI_Hs02_00515344 predicted 452
3 SASI_Hs02_00515345 predicted 834
4 SASI_Hs02_00515346 predicted 775
5 SASI_Hs02_00515347 predicted 1095
6 SASI_Hs02_00515348 predicted 828
7 SASI_Hs02_00515349 predicted 780
8 SASI_Hs02_00515350 predicted 827
9 SASI_Hs02_00515351 predicted 745
10 SASI_Hs02_00515352 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207367
ERVFC1-1 MISSION shRNA Bacterial Glycerol Stock
endogenous retrovirus group FC1, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-748s1c1
Sequence:CCGGCTGGCTGCAATATACCTTGGACTCGAGTCCAAGGTATATTGCAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207367.1-2388s1c1
Sequence:CCGGCCTGTGAATAACCCACCTCTTCTCGAGAAGAGGTGGGTTATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-841s1c1
Sequence:CCGGGAGGCGAGGCAAATAGTCAAACTCGAGTTTGACTATTTGCCTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-1046s1c1
Sequence:CCGGCCATCTTACTACCTGCTTCCTCTCGAGAGGAAGCAGGTAGTAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-755s1c1
Sequence:CCGGCAATATACCTTGGACAACCAACTCGAGTTGGTTGTCCAAGGTATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-814s1c1
Sequence:CCGGCCTAAACGACCTTACCAATTTCTCGAGAAATTGGTAAGGTCGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-805s1c1
Sequence:CCGGCTTCAATATCCTAAACGACCTCTCGAGAGGTCGTTTAGGATATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-975s1c1
Sequence:CCGGCTCTCTTGCCGTTAATCCTGTCTCGAGACAGGATTAACGGCAAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-790s1c1
Sequence:CCGGCAAAGGCACACTCGACTTCAACTCGAGTTGAAGTCGAGTGTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207367
ERVFC1-1 MISSION shRNA shRNA Plasmid DNA
endogenous retrovirus group FC1, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-748s1c1
Sequence:CCGGCTGGCTGCAATATACCTTGGACTCGAGTCCAAGGTATATTGCAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207367.1-2388s1c1
Sequence:CCGGCCTGTGAATAACCCACCTCTTCTCGAGAAGAGGTGGGTTATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-841s1c1
Sequence:CCGGGAGGCGAGGCAAATAGTCAAACTCGAGTTTGACTATTTGCCTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-1046s1c1
Sequence:CCGGCCATCTTACTACCTGCTTCCTCTCGAGAGGAAGCAGGTAGTAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-755s1c1
Sequence:CCGGCAATATACCTTGGACAACCAACTCGAGTTGGTTGTCCAAGGTATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-814s1c1
Sequence:CCGGCCTAAACGACCTTACCAATTTCTCGAGAAATTGGTAAGGTCGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-805s1c1
Sequence:CCGGCTTCAATATCCTAAACGACCTCTCGAGAGGTCGTTTAGGATATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-975s1c1
Sequence:CCGGCTCTCTTGCCGTTAATCCTGTCTCGAGACAGGATTAACGGCAAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-790s1c1
Sequence:CCGGCAAAGGCACACTCGACTTCAACTCGAGTTGAAGTCGAGTGTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207367
ERVFC1-1 MISSION shRNA Lentiviral Transduction Particles
endogenous retrovirus group FC1, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-748s1c1
Sequence:CCGGCTGGCTGCAATATACCTTGGACTCGAGTCCAAGGTATATTGCAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207367.1-2388s1c1
Sequence:CCGGCCTGTGAATAACCCACCTCTTCTCGAGAAGAGGTGGGTTATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-841s1c1
Sequence:CCGGGAGGCGAGGCAAATAGTCAAACTCGAGTTTGACTATTTGCCTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-1046s1c1
Sequence:CCGGCCATCTTACTACCTGCTTCCTCTCGAGAGGAAGCAGGTAGTAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-755s1c1
Sequence:CCGGCAATATACCTTGGACAACCAACTCGAGTTGGTTGTCCAAGGTATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-814s1c1
Sequence:CCGGCCTAAACGACCTTACCAATTTCTCGAGAAATTGGTAAGGTCGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-805s1c1
Sequence:CCGGCTTCAATATCCTAAACGACCTCTCGAGAGGTCGTTTAGGATATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-975s1c1
Sequence:CCGGCTCTCTTGCCGTTAATCCTGTCTCGAGACAGGATTAACGGCAAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207367.1-790s1c1
Sequence:CCGGCAAAGGCACACTCGACTTCAACTCGAGTTGAAGTCGAGTGTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks